Die Phobie vor Gentechnik von weiblichen, männlichen und sonstigen grünlichen Mitbürgern - im Weiteren kurz „Grünlinge“ genannt - ist immer noch die gleiche wie seit mehr als 30 Jahren. Somit konnte ich die Beiträge 01 bis 14, die schon Ende 2015 fertig waren, für den Blog bei „Simplesite“ ab Mitte 2017 nahezu unverändert lassen.

Stand 2015

 

(01.) ...Eigentlich wollte ich mal ein leicht verständliches Büchlein über Gentechnik schreiben...

Ich stellte mir vor, leicht verständlich für Tante Olga, Onkel Paul und den Neffen Karlchen...

 

(02.) ...eine wichtige Klarstellung...

Ich habe absolut nichts gegen Kultursorten, die ohne Gentechnik gezüchtet wurden und werden...

 

(03.) ...ein völlig unwissenschaftliches Argument für Pflanzen-Gentechnik...

Was würden Sie, lieber Leser, sagen, wenn da welche von einem "grünen" Verein daher kommen und über Ihren Beruf...

 

(04.) ...Schnelligkeit ist oft von riesigem Vorteil...

Wenn bei verändertem Klima Kulturpflanzen besser Trockenheit oder auch Nässe widerstehen sollen...

 

(05.) ...ein Gen ist dünn und lang...

Was denn genau ein Gen ist, kann niemand in zwei Sätzen erklären...

 

(06.) ...effizienter, sicherer, schneller, genauer...

Gentechnik umfasst neue fantastische Methoden zur Pflanzenzüchtung...

 

(07.) ...von radioaktiv und chemisch misshandelten Pflanzen, einem Tisch und Arbeitsteilung...

Sie haben bisher von Nudel-Buchstaben-Betriebs- und Konstruktionsanweisungen gehört..

 

(08.) ...gefährlich! Im Vergleich zu was?...

Was kann denn schon Schlimmes an ganz normaler Züchtung sein?...

 

(09.) ...öde Tabellen und eine Zugabe...

Dieser Beitrag beisteht nur aus zwei Tabellen mit einem Vergleich...

 

(10.) ...von Schmarren, Romantik und Feuer...

Wenn meine Frau Schmarren macht, ist er leicht und bekömmlich. Den esse ich mit Vorliebe. Aber diesen Schmarren meine ich jetzt nicht...

 

(11.) ... zur Abwechslung mal ein Flugblatt...

!!! Dies ist keine Reklame !!!...

 

(12.) ...zwei Text-Zitate und eine provisorische Antwort...

Wer weiß schon bis ins letzte Detail genau, wie ein Gen funktioniert?!...

 

(13.) ...ein Geheim-Code...

Kodieren und dekodieren mal ganz einfach..tttgtcttac ctaattattt atttattgtc...

 

(14.) ...Art, Art, Art...und ganz natürliche Gentechnik...

Ich hoffe, ich konnte Ihnen in Beitrag 13 andeuten, wie im Prinzip Lebewesen ihre Information verschlüsseln...

 

(Pause) ...und nichts vergessen!...

Falls sie es bis hierhin geschafft haben, haben Sie mir eine große Freude bereitet...

 und unbedingt weitersagen, wenn Ihnen das ein oder andere gefallen hat und Sie meinen, es könnte zum besseren Verständnis über Gentechnik beitragen.

 

 

 

 

01.



...Eigentlich wollte ich mal ein leicht verständliches Büchlein über Gentechnik schreiben...

Ich stellte mir vor, leicht verständlich für Tante Olga, Onkel Paul und den Neffen Karlchen, denn schließlich hatten die ja nicht so was wie Biologie, Molekularbiologie oder gar Pflanzenzüchtung studiert, sondern wie Sie, werter Blogbesucher, einen von vielen anderen Berufen ergriffen, die für die Gesellschaft genauso oder gar wichtiger sind.

Ich stellte mir vor, ich könnte den drei einleuchtend erklären, weshalb die gentechnisch gezüchteten Pflanzen sogar noch harmloser sind als die "normalen" und weshalb die grünen Grünlinge, die grünen Aktivisten, mit ihrem Verteufeln von "Genpflanzen" unrecht haben. In regelmäßigen Abständen fragte ich mich, ob mir Tante Olga, Onkel Paul und Karlchen wohl folgen könnten. Ob ich vielleicht mit meinen Ausführungen in ihnen eine gewisse Skepsis erwecken könnte gegenüber den hinterhältigen Rattenfängerparolen diverser grüner Verbände; eine gewisse Skepsis gegenüber diesen Grünlingen, die sich seit mehr als 30 Jahren moralisch aufplustern und über Gentechnik schräge Behauptungen verbreiten, obwohl ähnliches viel eher herkömmlichen Sorten angedichtet werden könnte.

Nach den ersten Seiten schienen mir Tante, Onkel und Neffe noch aufmerksam zuzuhören. Nach weiteren Ausführungen, die naturgemäß immer mehr Fachausdrücke enthielten, sah ich, wie ihnen manchmal die Augen zufielen und der Kopf nach vorne nickte. Manchmal waren sie dann etwas verlegen und meinten verschämt, das wäre ja alles hoch interessant, aber sie könnten mir besser folgen, wenn im Hintergrund leise Musik spielt.

Nun schlussendlich, während ich mich redlich mühte, blätterte Tante Olga in der Goldenen Revue, Onkel Paul verfolgte die Sportsendung in der Glotze und Karlchen bearbeitete mit hektischen Bewegungen seinen iPod. Ich kann ja ihr Desinteresse verstehen. Das Fach Biologie war für Tante und Onkel schon Vergangenheit, Karlchen hatte in der Schule dummerweise hin und wieder einen grünen Biologielehrer, mit romantischen Vorstellungen von Bio, Öko und Natur, der ihm mit Begeisterung das Vereinslied der Grünlinge vorträllerte: "Im Märzen der Bauer die Rösslein anspannt..." . Auch sonst wurde Biologie nicht besonders interessant erklärt. Wer möchte schon gerne chemische Formeln auswendig lernen, sich Stoffwechselwege einprägen oder sich mit Vererbungsvorgängen herumquälen, die zunehmend komplizierter werden. Nicht, dass die drei nicht gerne draußen in der Natur wären: Im Garten pflanzen, im Wald spazieren gehen, Vögel beobachten oder im Gebirge herumkraxeln; einen Zoo besuchen, am Strand entlang schlendern oder gar eine Safari unternehmen. Karlchen rennt sogar mit einem Pflanzenbestimmungsbuch durch die Gegend. Nicht dass sie sich nicht auch ärgern, wenn Mitmenschen die Umwelt mit Unrat und Giften versauen. Tante, Onkel und Neffe hatten aber andere berufliche Interessen als ich. Tante Olga ist für eine Bank tätig, Onkel Paul verlegt Fliesen und Karlchen will Jurist werden und hat sein zweites Semester begonnen.

So habe ich es schließlich aufgegeben, ihnen zu erklären, weshalb die Grünlinge in dieser Hinsicht völlig neben der Spur liegen. Ich habe es nicht geschafft, eine so komplexe Materie aus Genetik, Molekularbiologie, Biochemie, Pflanzenzüchtung und Gentechnik gewürzt mit ein wenig Mathe und Physik in einfachster Form darzustellen. Wie soll das auch gehen? Selbst bei wirklich interessierten Leuten dauert ein Studium schon Jahre! Und danach im Beruf geht's mit Lernen und Erfahrungen sammeln weiter.

So beschloss ich kurzerhand, so was wie einen Blog einzurichten.

Im Lauf der letzten Jahre habe ich meinen Frust über die ignoranten grünen Aktivisten nicht nur in Bezug auf Gentechnik auf Blätter gekritzelt oder getippt. Und dann, nachdem ich mich ein wenig beruhigt hatte, gammelte der Frust in irgendeiner Schublade oder einer Computerdatei vor sich hin.

Nun dürfen Sie, lieber Leser, daran teilhaben. In zwangloser Reihenfolge lasse ich einiges davon auf meine Mitmenschen los. Wie gesagt, damit Tante Olga, Onkel Paul und Karlchen nicht nach den ersten Sätzen wegklicken, werde ich die Dinge, so einfach wie ich nur kann, darstellen. Denn was die Kenntnisse über grüne Gentechnik (Pflanzen-Gentechnik) betreffen, so stehen die drei stellvertretend für sicher weit mehr als 90% der Bevölkerung. Wenn dem nicht so wäre, dann ließe sich nicht der größte Teil einschließlich der Politiker von den Grünlingen an der Nase herum führen. Nun ist Deutschland nicht Oklahoma (USA). Warum ich das erwähne? Weil dort in einer Umfrage ca. 80% von rund 1000 zufällig Befragten nicht nur Nahrungsmittel gekennzeichnet haben möchten, die irgend etwas mit Gentechnik zu tun haben, sondern auch alle Nahrungsmittel, die DNA enthalten! Sie finden Letzteres auch richtig? Dann  kann ich Sie nur inständig und flehendlich bitten weiterzulesen, zumindest noch den Beitrag 3.

Wiederholungen wird's in meinem Blog ab und zu geben. Das macht nichts. Wiederholungen gibt's auch im Fernsehen. Und auf den Webseiten der Grünlinge finden wir ununterbrochen und andauernd Wiederholungen vom gleichen Unfug, was die Gentechnik anbelangt.

Es wäre natürlich toll, wenn es mir gelänge den einen oder anderen Skeptiker oder gar Anhänger von Katastrophen-Szenarien zu überzeugen, dass man Pflanzenzüchtung mit Gentechnik zumindest eine faire Chance geben muss und nicht alle so entstandenen Kultursorten pauschal verteufeln darf.

Eigentlich gibt es sie ja: Lehrbücher und Internetseiten von richtigen Experten auf denen über grüne Gentechnik vernünftig, sachlich, ausgewogen und korrekt berichtet wird.

Aber leider oft kompliziert: Fachausdrücke, Fachausdrücke, Fachausdrücke. Kein Wunder, dass Sie die Zeitschrift, das Buch zuklappen oder die Internetseite wegklicken.

Zumindest hatte ich mir vorgenommen, mein Geschreibsel so einfach und anschaulich wie möglich zu verfassen. Und mich würde es freuen, wenn sich diejenigen, denen "Gentechnik" auch nicht mehr sagt als Tante Olga, Onkel Paul und Karlchen, nach dem Lesen ein wenig weniger vom ganzen Zinnober der Grünlinge beeinflussen ließen.

Für die "Fortgeschrittenen" habe ich im Folgenden geeignete Webseiten von richtigen Experten zur grünen Gentechnik aufgeführt.

 

Hier ein paar Webseiten, die versuchen, objektiv über Gentechnik und grüne Gentechnik (Pflanzen-Gentechnik) zu informieren:

 

 

www.transgen.de (hier gibt es ausführliche Information und eine Reihe von weiteren Links zu verschiedenen Broschüren über "Grüne Gentechnik")

www.gruenevernunft.de (hier sei besonders auf die Rubrik "Publikationen" hingewiesen)

www.pflanzen-forschung-ethik.de

www.pflanzenforschung.de/de/startseite

► Deutsche Forschungsgemeinschaft (DFG): www.dfg.de/download/pdf/dfg_magazin/forschungspolitik/gruene_gentechnik/broschuere_gruene_gentechnik.pdf

//www.novo-argumente.com/artikel/was_ist_heute_gentechnik (siehe auch: //www.pflanzen-biotechnologie.de/menue/startseite/)

www.die-pflanzenzuechter.de/ suchen Sie unter den Stichworten „Gentechnik“, „grüne Gentechnik“, „Gentechnik bei Pflanzen“

► Verband Biologie, Biowissenschaften und Biomedizin. www.vbio.de/ (Suchen Sie dort nach "Grüne Gentechnik)

► Bundesministerium für Bildung und Forschung: www.biosicherheit.de

► Deutsche Akademie der Naturforscher Leopoldina: www.leopoldina.org/de (Suchen Sie dort nach "Grüne Gentechnik) u.a. auch

....www.leopoldina.org/fileadmin/redaktion/Publikationen/Nationale_Empfehlungen/200910_NatEmpf_Gruene_Gentechnik-DE.pdf

► Leibniz-Gemeinschaft: www.leibniz-gemeinschaft.de (Suchen Sie dort nach "Grüne Gentechnik)

► Max-Planck-Gesellschaft: www.mpg.de (suchen Sie hier nach Pressemitteilungen über "Grüne Gentechnik)

www.uni-bielefeld.de/Universitaet/Einrichtungen/Zentrale%20Institute/IWT/FWG/Paradys/Gentechnik.html

► Agrarfakten: www.agrarfakten.de/grune-gentechnik/

► eine schweizer Webseite: //www.gensuisse.ch/de/themen/gruene-gentechnologie#

und hier noch die Meinungen

► einer Philosophin: //schillipaeppa.net/; da einfach was zu Gentechnik suchen

► eines Lebensmittelchemikers: www.euleev.de; da einfach was zu Gentechnik suchen

► eines Landwirts: //www.bauerwilli.com/

► eines deutschen Saatzuchtunternehmens: KWS SAAT AG (ehemals Kleinwanslebener Saatzucht): www.kws.de (suchen Sie nach "Grüne Gentechnik" oder auch "Downloads")

► und kurze Antworten von einem großen amerikanischen Unternehmen (dem gemeinsamen Feind aller Gentechnik-Kritiker): www.monsanto.com/global/de/news-standpunkte/documents/myths-facts-de.pdf auf die nicht enden wollenden Vorwürfe von Grünlingen.

 

Auf den genannten Webseiten finden Sie oft weitere „Links“ zu anderen interessanten Seiten.

Sie können auch bei Wikipedia nachschlagen. Behalten Sie aber immer im Hinterkopf: Bei Wikipedia kann man nie ganz sicher sein, ob nicht gerade ein selbsternannter Experte seine Meinung dort hingekritzelt hat.

 

Damit sich Grünlinge nicht benachteiligt fühlen, hier noch ein paar wenige andere Webseiten. Denen sollte man sich, was die Information über Gentechnik und insbesondere Pflanzengentechnik anbelangt, wirklich mit größtmöglicher Skepsis nähern. Denn Vorsicht: Informations-Manipulations-Gefahr! Das Risiko nur die halbe Wahrheit zu erfahren, ist riesig. Deshalb habe ich diesen Absatz auch ziemlich klein geschrieben. greenpeace.de, bund.net, (Des)informtionsdienst Gentechnik:keine-gentechnik.de, testbiotech.org, foodwatch.org/de, umweltinstitut.org/home.html, gen-ethisches-netzwerk.de, usw, usw, usw, usw.......

 

 

02.



... eine wichtige Klarstellung...

Ich habe absolut nichts gegen Kultursorten, die ohne Gentechnik gezüchtet wurden und werden. Alte Landsorten muss man schützen und erhalten. Jeder seriöse Züchter - auch in großen Saatgut-Konzernen - würde dies voll unterstützen. Ich habe absolut nichts gegen Öko-Landbau. Im Gegenteil, positive Erfahrungen mit dieser Methode sollte man sich im produktiven konventionellen Landbau zu Nutze machen. Wer mit Öko-Landbau glücklich und zufrieden ist, und damit seinen Lebensunterhalt verdienen kann, dem sei es von Herzen gegönnt. Wenn einer "Bio"-Produkte für sein Seelenheil braucht, soll er sie gerne kaufen.

Wer aber über moderne Pflanzenzucht und modernen Anbau bewusst Falsches verbreitet, wer Tatsachen verdreht, Negatives aufbläst und Positives klein redet oder gar verschweigt und seine Mitmenschen auf diese Weise täuscht und ängstigt, der ist keinen Deut besser als die Verantwortlichen von Firmen, die Kunden mit unlauteren Versprechen locken.

"Je öfter eine Dummheit in der Öffentlichkeit wiederholt wird, desto mehr bekommt es den Anschein der Klugheit." Das Zitat stammt wohl von Voltair. Und über grüne Gentechnik wird kübelweise von Grünlingen dummes Zeug verbreitet. Leicht in die Welt gesetzt, wird es dann von einer Generation zur nächsten mitgeschleppt; von kaum einem mehr kritisch hinterfragt. Die meisten richtigen Fachleute resignieren frustriert; denn wieviel Zeit und Mühe kostet es, Irrtümer wieder richtig zu stellen! [1]

Sie wollen sicher wissen, was ich denn so über Gentechnik weiß. Nun über 40 Jahre war ich entweder in Mikrobiologie, Genetik oder (die längste Zeit davon) in Pflanzen-Gentechnik - tätig. Ein Anti-Gentechnik-Aktivist, der sich nur einen Bruchteil dieser Zeit mit Lesen von Anti-Gentechnik-Pamphleten beschäftigt hat, würde sich als "Experte" bezeichnen. Nun können Sie sich ein ungefähres Bild machen.

Vereinfacht man Dinge, die wie Züchtung tatsächlich höchst kompliziert sind, lässt es sich nicht verhindern Vieles pauschal abzuhandeln. Pauschales kann nicht hundertprozentig genau sein. Zahlen, die ich angebe, sind meist grob angenähert; nur um einen Eindruck von Größenordnungen zu vermitteln. Analogien sollen zum Verständnis beitragen. Jede Analogie ist angreifbar.

Biologie zeichnet sich durch eine ungeheure Vielfalt der Dinge aus. Trotzdem kann man auch in der Biologie, wenn man experimentiert, sehr häufig Voraussagen machen, die zutreffen. Meist nicht so oft und genau wie in Physik und Chemie, aber oft genau genug, um zu sagen, ob etwas wirklich gefährlich ist oder nicht. Sehr viele Einzelheiten, wenn auch längst nicht alle, können richtige Experten überschauen und richtig interpretieren. Richtigen Experten sollte man eher vertrauen, eher jedenfalls als esoterischen Wahrsagern und Hellsehern mit grünen Glaskugeln. So, wie wir Technikern und Monteuren vertrauen, die Autos konstruieren und zusammenbauen; so, wie wir uns im Vertrauen auf eine gute Reise in den Bus, die Bahn oder das Flugzeug setzen; so, wie wir vertrauensvoll in den von Architekten und Handwerkern geplanten und errichteten Häusern wohnen [3] und so, wie wir den Züchtern und Landwirten vertraut haben, bis dann vor etwa 30 Jahren die Grünlinge anfingen Misstrauen zu sähen.

Und wenn dann Grünlinge sofort einwenden: "Ja aber beim Atom ...." Dann stimmt das so nicht, dann ist das kein Argument gegen Gentechnik, sondern gegen fast jede Technik. Man wusste schon wenige Jahre nach der Entdeckung der Radioaktivität, dass zu viel davon in kurzer Zeit ungesund sein kann. Aber zu viel davon in kurzer Zeit, das trifft für fast alles zu: Alkohol, Karotten, Dioxin, Fett, Sauerstoff, Schokolade, Sport, dicke Bohnen, ja selbst Wasser. Eigentlich ist das ein anderes Thema.

Und noch eine Klarstellung: Weil das Internet mit pseudowissenschaftlichem Unrat vollgekübelt wird und ich keine Lust habe mich noch mehr frusten zu lassen, verzichte ich hier auf eine Kommentarfunktion, auf kindische Knöpfchen wie "like" und "dislike", auf Hinweise zu (a?)sozialen Netzwerken und Köttel[2]-Informationsdiensten.

 

Sollte Ihnen das ein oder andere in diesem Blog aber gefallen, dann wäre es nett, Sie sagen es weiter und verweisen auf diese Webseite.

 

Zum Nachschauen oder zur Ergänzung:

[1] z.B. Walter Krämer, Götz Trenkler: Lexikon der populären Irrtümer; Walter Krämer, Götz Trenkler, Denis Krämer: Das neue Lexikon der populären Irrtümer; Walter Krämer, Gerald Mackenthun: Die Panik-Macher; Dirk Maxeiner, Michael Miersch: Lexikon der Öko-Irrtümer; Dirk Maxeiner, Michael Miersch: Biokost & Ökokult. Alle Bücher erschienen im Piper Verlag. [2] So bezeichnet man im rheinischen Sprachgebrauch meist kleine Kotklümpchen wie sie z.B Kaninchen u.a. produzieren. [3] auch wenn wir Überlegungen oder Berechnungen im Detail nicht nachvollziehen können, weil wir selbst auf diesen Gebieten eben keine Experten sind.

 

 

03.



...ein völlig unwissenschaftliches Argument für Pflanzen-Gentechnik...

Was würden Sie, lieber Leser, sagen, wenn da welche von einem "grünen" Verein daher kommen und über Ihren Beruf, Ihre Tätigkeit, Ihre Arbeit und die Produkte, die Sie vielleicht herstellen, permanent Unfug oder halb Wahres von sich geben und Positives weglassen? Vielleicht haben Sie ja einen Beruf, den es vor einigen Jahrzehnten oder im letzten Jahrhundert noch nicht gab und bei dem in den Anfängen die eine oder andere Schwierigkeit auftauchte. Was würden Sie sagen, wenn diese Tugendwächter heute immer noch den gleichen alten längst überholten Kram wiederkäuen und behaupten, wie schlimm es um die Produkte Ihrer Arbeit bestellt ist? Ihnen würde der Kamm anschwellen. Sie würden einen roten Kopf kriegen und sich fürchterlich über diese selbst ernannten "Experten" aufregen.

Lassen Sie sich von dem Wörtchen "Grün" nicht täuschen. Nicht jeder der gerne im Grünen sitzt oder auch durch's Grüne streift, ein paar Haustiere hält, in seinem Schrebergarten Gemüse zieht oder sogar selbst eine neue Rosensorte gezüchtet hat, hat Ahnung von professioneller moderner Pflanzenzüchtung. Und die brauchen wir; auch um Überschüsse zu erzeugen. Denn wer sollte sonst bei grottenschlechten Ernten, bei Missernten, die davon Betroffenen unterstützen? Ökologische Landwirtschaft, auch wenn sie damals noch nicht so hieß, die hatten wir von den Anfängen unserer Geschichte bis heute. Aber konnte sie die vielen Hungerkatastrophen verhindern? Da, wo man Ökoanbau betreibt, kann man nur wenige ernähren, aber nicht all die Menschen, die unsere Großstädte und Metropolen bevölkern.

Ich will Sie nicht langweilen. Daher gleich ein Argument gegen die grünlichen Weltretter, was aber eigentlich gar kein Argument ist. Es kann aber schon mal - so hoffe ich - Ihre Skepsis gegen Pseudoexperten ein wenig vergrößern: Amerika!

Amerika? Was um alles in der Welt hat Amerika mit Gentechnik zu tun?

Nun. Jahr für Jahr werden in den USA und Kanada, aber auch z.B. in Brasilien und anderswo zunehmend mehr gentechnisch veränderte Pflanzen kultiviert. Allein in den USA waren es 2013 etwa siebenhundertausend Quadratkilometer. Das ist eine Fläche so groß wie Deutschland, die Schweiz und Italien zusammen, komplett. Denken Sie sich alle Felder, Wälder, Wiesen und Städte komplett bedeckt mit diesen Pflanzen. Halten Sie einen Moment inne! Schauen Sie sich um, so weit Sie blicken, soweit Sie Stunde um Stunde mit ihrem motorisierten Untersatz durch Deutschland von Aachen im Westen bis Dresden im Osten fahren, von Schleswig-Holstein im Norden, über die schweizer Alpen bis Sizilien im Süden von Italien: Nur Felder mit "Genpflanzen" [3].

Ich persönlich mag den Ausdruck "Genpflanzen" absolut nicht. Erwähne ihn aber hier, da die grünen Pseudoexperten so die neuen Kultursorten nennen. Dabei hoffen sie, dass diejenigen, die vielleicht in Biologie nicht ganz so gut aufgepasst haben oder - schlimmer noch - einen "grünen" Lehrer hatten, darauf hereinfallen.

Lassen Sie sich nicht ins Bockshorn jagen. Jeder von uns ist vollgestopft mit Genen. Jede Ihrer Körperzellen enthält Gene, also Erbanlagen; so etwa 60.000. Ein Erwachsener hat geschätzt 37 Billionen Zellen [4],[11]. Also rechnen wir mal und runden dabei, um nicht zu übertreiben, großzügig nach unten ab: 37.000.000.000.000 mal 60.000 macht abgerundet 2 Trillionen insgesamt und je Kilogramm so 40 Billiarden Gene (Erbanlagen). Legen Sie mich nicht fest, ob es es ein paar Billiarden mehr oder weniger sind. [8]

Auch Pflanzen haben in (fast) jeder Zelle ähnlich viele Gene wie wir, manche Arten einige Tausend weniger, manche einige 10.000 mehr. Pflanzenzellen sind durchschnittlich einiges größer als die von Tieren. Somit passen weniger Zellen in ein Kilo, sagen wir - Pi mal Daumen - 100 mal weniger. Dann würden sich in einem Kilogramm Früchte, Samen, Blätter, Knollen oder Wurzeln immerhin noch 400 Billionen Gene tummeln. [5][9]

Einen großen Biss in einen Apfel und Sie haben 8 Billionen Apfel-Gene im Mund, die Sie dann, nachdem Sie genüsslich gekaut haben, herunterschlucken und verdauen. Aber es sind ja nicht nur Äpfel; heute vielleicht Schweinekotelett mit Kartoffeln und gemischtem Salat und morgen Lachs mit Reis und Erbsen-Karotten-Gemüse. Alles mit riesigen Mengen an Genen und alles durcheinander. Dazu kommen noch - Sie werden es kaum glauben - geschätzte 100 Billionen Mikroben in unserem Darm [10]. Auch die haben Gene. Ich runde mal wieder großzügig ab, um nicht zu übertreiben, und sage alle zusammen: 100 Billiarden Gene. Hie und da sterben Mikroben ab, platzen auf und schon schwimmen deren Gene in unserem Darm herum. Die meisten davon Bakterien-Gene!

Es kann schon sein, dass bei so riesigen Zahlen einige winzige Gen-Schnippsel von Tomaten, Lachs, Kartoffel oder was immer Sie gegessen haben, die Verdauungsprozedur überstehen, irgendwie die Darmwand passieren und sich dann mit raffinierten Methoden sogar in Ihrem Blut nachweisen lassen. Machen Sie sich keine Sorge. Alle Ihre Vorfahren müssen das ja irgendwie überstanden haben. Dass in allen Lebewesen Gene, also Erbanlagen stecken, hat nun zunächst einmal nichts, aber auch gar nichts, mit Gentechnik zu tun.

Oder sagen wir so, gentechnisch gezüchtete Kulturpflanzen haben, statt 60.000 Gene je Zelle so 2 bis 10 Gene mehr. Gemittelt macht das z.B. 60.006 statt 60.000. Ein wahnsinniger Unterschied, nicht wahr? Denken Sie daran, sollten Sie in Amerika mal gentechnisch veränderten Mais essen, dann bitte kein ganzes Kilo, sondern ein halbes (!) Maiskorn weniger. Das nur angemerkt, damit Sie nicht zu viele Gene essen.

Und damit wären wir wieder bei Amerika:

Wenn diese "Genpflanzen" wirklich so gefährlich wären, dann hätte es doch in Amerika schon längst eine wahre Flut von Klagen mit Millionen-Dollar-Forderungen gegeben; auch gegen Großkonzerne ist man da nicht zimperlich [12]. Wir belächeln gerne die Amis, denen man nachsagt, gegen alles mögliche und unmögliche zu klagen. Und? Schon von so einer Klagewelle gegen "Genpflanzen" gehört? Nun, nicht? Sehen Sie, allein das ist doch ein wirklich überzeugendes Argument - kein wissenschaftliches - aber ein überzeugendes: So schlimm können "Genpflanzen" also nicht sein [6].

Grünlinge mögen jetzt gleich protestieren und die rührselige Geschichte von dem armen nordamerikanischen Bäuerchen [7] erzählen. Aber über diese Geschichte können Sie sich selbst im Internet informieren.

Apropos Patent: Das ist so was ähnliches wie Sortenschutz in Deutschland. Wenn ich sortengeschütztes Saatgut vermehre und vermarkte oder auch Produkte davon vertreibe, dann muss ich dem Hersteller was zahlen. Wieso auch nicht? Welche Firma steckt schon gerne jahrelang viel Geld in Forschung und Entwicklung, bezahlt hochqualifizierte Mitarbeiter und übernimmt auch sonst noch alle Unkosten, die während der ganzen Zeit anfallen? - Ich weiß, Ökobauern und Biolandwirte arbeiten umsonst. Und noch was: Ein Patent läuft nach 20 Jahren aus und das ist zur Zeit mit den ersten Patenten für zugelassene gentechnisch veränderte Pflanzen der Fall. Übrigens, Sortenschutz kann u.U. sogar länger bestehen als ein Patentschutz. Kein Landwirt - egal in welchem Land der Erde - wird gezwungen gentechnisch gezüchtete Sorten, die Patentschutz haben, anzubauen. Wenn er sie anbaut, dann muss er sich aber an die Regeln halten.

Von althergebrachten Sorten kann er so viel anbauen wie er will, ohne irgendeinen zu fragen.

 

Zum Nachschauen oder zur Ergänzung:

[3] Auf der übrigen Welt kommen noch 1 Million Quadratkilometer dazu. In Europa fast nichts. [4] Bianconi et al.: An estimation of the number of cells in the human body. Ann Hum Biol, Early Online: 1-11. (2013). [5] Die Zahlen sind wirklich nur grobe Schätzungen. Wenn Sie z.B. lesen eine Pflanze hat 30.000 Gene, dann hat sie 30.000 in jeder einzelnen lebenden Zelle. Meistens ist damit die Zahl der Gene in den (haploiden) Fortpflanzungszellen gemeint. Die anderen Zellen haben dann doppelt so viel, also 60.000. Merken Sie sich nur: Alle zusammen sind es wahnsinnig viele. [6] eigentlich sollte ich diesen von Grünlingen erfundenen und abschätzig gemeinten Ausdruck gar nicht verwenden. Er ist zudem noch völlig falsch, denn Lebewesen ohne Gene gibt es nicht. [7] mit Namen Percy Schmeiser. [8] Gene in den Zellorganellen (also außerhalb des Zellkerns im Cytoplasma) sind dabei noch nicht einmal berücksichtigt: 37 Gene je Mitochondrium (Organell), 1000 Mitochondrien je Zelle, 37 Billionen Zellen je Mensch ergibt abgerundet 1 Trillion Gene zusätzlich (grobe Schätzungen). [9] Hier gilt Ähnliches wie in Anmerkung 8. Die Gene in Mitochondrien plus die in den Chloroplasten sind dabei noch gar nicht berücksichtigt. [10] Sekirov et al.: Gut microbiota in health and disease. Physiol. Rev. 990, 859-904 (2010). [11] Sie müssen aufpassen: Im US-Englischen benennt man große Zahlen anders als im Deutschen. Zum Beispiel: Billion (US-engl.) = Milliarde (deutsch); Trillion (US-engl.) = Billion (deutsch); Quadrillion (US-engl.) = Billiarde (deutsch); Quintillion = Trillion; usw. [12] Beispiel im September 2015: VW-Konzern, der Welt größter Autohersteller mit seinen nicht ganz richtigen Diesel-Abgas-Tests.

 

 

 

04.



...Schnelligkeit ist oft von riesigem Vorteil...

wenn...

► bei verändertem Klima Kulturpflanzen besser Trockenheit oder auch Nässe widerstehen sollen,

► neue Krankheitskeime und Getier bei unseren Nahrungspflanzen weniger Schaden anrichten soll,

► die Qualität von Pflanzeninhaltsstoffen gesteigert werden soll,

► der Geschmack verbessert werden soll,

► Pflanzen, die für manche unverträglich sind, verträglich gemacht werden sollen,

► die Ernteverfahren verbessert werden sollen,

► die Lagerfähigkeit verbessert werden soll,

► die Resistenz gegen Pflanzenkrankheiten erhöht werden soll,

► also Kulturpflanzen mit allen erdenklichen für uns und den Landwirt nützlichen Eigenschaften ausgestattet werden sollen oder es schnell gehen muss, wenn neue Schädlinge unsere Ernten bedrohen,

dann...

wäre ein Züchtungsverfahren, das nur die Hälfte, ein Viertel oder noch weniger an Zeit braucht eine wunderbare Sache; statt zehn nur zwei Jahre, statt vier Jahre nur ein Jahr je nach Pflanzenart.

So ein schnelles Verfahren gibt es: Gentechnik.

Es ist schneller. Es ist tatsächlich schneller. Aber nicht bei uns in Europa. Es wäre schneller, wenn nicht völlig überflüssige jahrelange Tests mit den gezüchteten Sorten durchgeführt werden müssten. Die haben bis jetzt zu keinem anderen Ergebnis geführt, als dass praktisch alle Sorten den herkömmlich gezüchteten in puncto Sicherheit in Nichts, aber auch gar Nichts nachstehen. Im Gegenteil: Sie sind schon allein dadurch sicherer, dass diese unnötigen Tests überhaupt gemacht wurden. [1] Und lassen Sie sich da nicht durch immer mal wieder durch die Medienlandschaft geisternde Berichte von angeblichen "krebsfördernden Genpflanzen" verunsichert. Das ist Trommelwirbel um Nichts mit dem einzigen Grund Sie, lieber Blog-Besucher, zu verunsichern. Und was Sie sonst noch an Horrormeldungen hören, hat nichts mit Gentechnik an sich zu tun. Schlamperei bei der Anwendung von Spritzmittel, das Missachten ackerbaulicher Regeln, des Arbeitsschutzes und andere unschöne Dinge, das finden Sie auch in der herkömmlichen Landwirtschaft. Nur, die Berichte darüber in den Medien müssen Sie mit der Lupe suchen, unscheinbar und als Randnotizen. Und fette Schlagzeile wie diese: "Gefahren lauern heimtückisch im Ökoanbau" oder "Unkalkulierbare Risiken im konventionellen Landbau", finden Sie auch nicht.

Fragen wir dochmal kritisch, wie es eigentlich mit der Kenntnis über Risiken und Gefahren bei den althergebrachten Sorten bestellt ist! Auch da gibt es ja laufend neu gezüchtete Sorten, die auf den Markt gebracht werden. Die Antwort ist: "Nichts Genaues weiß man". Kein Wust an Untersuchungen ist nötig; obwohl alles undefinierter, unberechenbarer, unsicherer, unerforschter ist, wenn eine "herkömmliche" Sorte zum ersten Mal auf den Markt kommt. Und das schon so lange Menschen überhaupt Pflanzen für ihre Nahrung auslesen. Diejenigen, die die falschen Sorten ausgesucht haben, sind daran erkrankt, vielleicht sogar verstorben. Mehr oder weniger unfreiwillige Selbstversuche mit jeder neu entstandenen oder neu gezüchteten Sorte; Selbstversuche die schon jahrtausendelang andauern mit immer neuen Sorten und wir haben's überlebt. Wir haben auch die herkömmliche Züchtung überlebt, die ab etwa 1930 den Schnellgang eingelegt hat durch den Einsatz radioaktiver Strahlung und mutagener Stoffe. Für die damalige Zeit (erste Hälfte des 20. Jahrhunderts) waren das ganz neue Techniken, die wesentlich zur "Grünen Revolution" beigetragen haben. Übrigens Grüne Revolution hat absolut nichts mit selbst ernannten grünen Experten zu tun, sondern bezeichnet einfach die Tatsache, dass es gelang wesentlich höhere Ernteerträge zu erzielen, u.a. durch ein ganzes Spektrum neu gezüchteter besserer Sorten. Ein Drittel aller Kultursorten, die heute (noch) vertrieben werden, so schätzt man, stammen von Überlebenden der drastischen Behandlungen mit radioaktiver Strahlung und toxischen Stoffen. ABER: Nichts Genaues weiß man. ODER: Niemand will es bei diesen "herkömmlich" gezüchteten Kultursorten so genau wissen. Weshalb eigentlich nicht?

Pflanzenzüchtung mit Gentechnik ginge noch schneller - im Turbogang sozusagen - und weniger martialisch, wenn, ja wenn eben nicht jahrelang völlig überflüssige Tests gemacht werden müssten. Wie gesagt, alle diese akribischen Untersuchungen haben zu keinem anderen Ergebnis geführt, als dass gentechnisch gezüchtete Pflanzen ungefährlicher sind als herkömmlich gezüchtete! Und es ginge auch noch schneller, wenn nicht auf Testfeldern Horden von sogenannten "Feldbefreiern" herumtrampeln würden und wie Affen mit Knüppeln auf die Pflanzen eindreschen und sie herausreißen würden.

 

Zum Nachschauen oder zur Ergänzung:

[1] Bundesministerium für Bildung und Forschung: www.bmbf.de/pub/BMBF_zur_biologischen_Sicherheitsforschung.pdf

 

Nicht vergessen:

► Weltweit wurden in 2013 auf 1,7 Millionen Quadratkilometer gentechnisch gezüchtete Nutzpflanzen angebaut. Beitrag 03.

► Wenn wir nicht gerade fasten, dann essen wir jeden Tag viele Milliarden fremde Gene oder - was das gleiche ist - viele Milliarden fremde Erbanlagen. Beitrag 03.

 

 

 

 

05.



...ein Gen ist dünn und lang...

Was denn genau ein Gen ist, kann niemand in zwei Sätzen erklären. Anfängerbücher in Genetik sind dick, mindestens 500 Seiten, die meisten sogar noch viel umfangreicher.

Trotzdem möchte ich Sie, der Sie ja kein mehrjähriges Biologiestudium absolviert haben und keine jahrelange Erfahrung auf diesem Arbeitsgebiet besitzen, auch einmal - nur ganz kurz - mit ein paar Fachausdrücken und Definitionen beeindrucken, so wie es grüne Pseudoexperten gerne machen. Das Folgende habe ich aus dem Glossar von zwei Lehrbüchern abgeschrieben, die auf den Regalbrettern in meiner Wohnung stehen. Wenn Sie es nicht lesen wollen, überspringen Sie einfach den kursiv geschriebenen Teil.

Ein Gen ist

...laut Buch Nr. 1 ein DNA-Segment, das biologische Informationen enthält und daher eine RNA und/oder ein Polypeptidmolekül kodiert. [1]

...laut Buch Nr. 2 die fundamentale physikalische Einheit der Vererbung deren Existenz durch Allelvarianten bewiesen werden kann, die einen spezifischen Locus auf einem Chromosom besetzen. Eine DNA-Sequenz, die ein einziges Polypeptid codiert. [2]

HALT. Noch nicht wegklicken. Gleich wird's einfacher. Nur noch schnell die Definition aus Wikipedia vom 21. Juli 2014 (die allerneuste könnten Sie aber auch ruhig selbst nachgucken):

"Als Gen wird meist ein Abschnitt auf der DNA bezeichnet, der die Grundinformationen zur Herstellung einer biologisch aktiven RNA enthält. Bei diesem Herstellungsprozess (Transkription) wird eine komplementäre Kopie des codogenen Stranges in Form der RNA hergestellt."

Nach einigen weiteren Erklärungen erfolgt dann noch mal eine Definition, weil man mit der ersten wohl nicht ganz zufrieden ist.

Ein Gen ist demnach: "eine Einheit aus genomischer DNA-Sequenz, die einen zusammenhängenden Satz von potenziell überlappenden funktionellen Produkten codiert".

 

Alles klar? Nicht? Dann möchten Sie sicher die englische Fassung dieses Satzes hören, die auch da steht? Nicht? Und ich dachte Englisch in der deutschen Sprache erhöht die Verständlichkeit. Wie ich mich täuschen kann!

Jetzt folgen bei Wikipedia noch ein paar Seiten mit weiteren Erläuterungen und Ausdrücken, und natürlich jede Menge Verweise (Links), die vermutlich lauter Fragezeichen in Ihrem Kopf produzieren.

Glauben Sie mir: Gen, das ist eher ein Konzept. So, wie viele Begriffe aus unserem Alltag eher Konzepte sind, als ganz konkret durch Definitionen zu fassende Dinge. Konzepte werden nur denen verständlich, die sich lange und gründlich damit beschäftigen. Das erfordert viel Interesse und auch Geduld.

Sie, lieber Blog-Leser, brauchen jetzt nur ein bisschen Fantasie.

Gene sind Erbanlagen und bestehen aus Materie, aus einem bestimmten Stoff, den die Biochemiker kurz DNA [4] abgekürzt haben; also zunächst mal gar nichts Esoterisches und es tut auch nichts zur Sache, wenn Sie sich unter DNA nichts vorstellen können. DNA enthält Information, so wie gedruckte Betriebs- und Konstruktionsanweisungen aus Papier, das können Sie anfassen, aber es müssen auch Buchstaben drauf sein. Die Buchstaben sind meist aus Druckerschwärze, aber sie könnten auch eingestanzt oder erhaben sein. Denken Sie nur an die Blindenschrift. Übrigens, aufgereinigte DNA können Sie auch anfassen. Fühlt sich ein bisschen an wie Watte. Nur die "Buchstaben" aus denen DNA besteht, die sind zu klein, um sie zu sehen und zu ertasten.

Stellen wir uns mal vor, ein irrer Erfinder kommt auf die Idee eine essbare Konstruktionsanleitung zu entwerfen. Er kauft sich eine Nudelmaschine, stellt einen ziemlich zähen, festen und widerstandsfähigen Teig her. Und was kommt am Ende heraus?

Richtig! Aneinander hängende, fast unendliche lange, ziemlich reißfeste, aber noch flexible Nudel-Buchstaben-Bänder. Alle Buchstaben genau in der Reihenfolge wie Sie auch von Seite 1 bis auf Seite 388.950 oder von Seite 388.951 bis Seite 795.749 [5] der originalen Anleitung vorkommen. Nudel-Buchstabe für Nudel-Buchstabe an der richtigen Stelle. Wer keine Nudeln mag, darf sich auch was anderes ausdenken, vielleicht endlose Lakritz-Buchstaben-Rollen.

Herr, lass Hirn vom Himmel regnen. Was hat das mit DNA zu tun? Viel. Denn eine wichtige Tatsache ist: DNA ist essbar, also sind auch Gene oder Erbanlagen essbar! Klingt makaber, aber es ist so! Wenn man statt DNA Nudeln schreibt, klingt es völlig normal. Gucken Sie in Beitrag 03 nach. Und vergessen Sie das bitte nie mehr! Essbar! Je natürlicher und weniger zubereitet Fleisch, Gemüse und Obst sind, desto mehr völlig intakte Gene. Also merken: Keine Angst mehr vor Genen. Fremde Gene sind nichts Schlimmes. Wir alle essen jeden Tag einen riesigen Haufen fremder Gene!

Buchstaben-Nudelbänder als Betriebs- oder Konstruktionsanweisungen. Ziemlich skurril, aber nicht für die Natur.

Die Natur hält das für eine gute Idee und hat sich zu diesem Zweck vier Buchstaben ausgesucht. Nur vier Buchstaben, deren abgekürzte Namen [6] sich jeder gut merken kann: A, C, G, T oder auch klein geschrieben a, c, g, t. Diese Buchstaben hängen zusammen, nicht durch Nudelteigstege, sondern durch Molekülbindungen. Wollen Sie wirklich den chemischen Bindungstyp wissen? Na gut: Phosphodiesterbindung. Egal. Hier mal ein winziges Stückchen von so einer DNA, was zugleich ein kleines Stückchen vom Anfang eines Gens mit Namenskürzel "sbe2.1" enthält [7]. Sie müssen es nicht lesen und auch nicht auswendig lernen, nur mal anschauen:

..tttgtcttac ctaattattt atttattgtc gtttggtaat aataaataac agttcatgtt tacaatatga tattttcctt attcatactt ggtatatgct ttattctcta gtgattctca ttacaaagat atttgtgcaa gtttggactc gtcccaaatc aagaaaaatg ttgtagtcaa aatgcttttc agttacgagt ctgaaacctg acaacacaaa attataaatt gtttttattt attttttcct aatcaaaacg attttttcct aatataaaat ttgatatttt gaggggtaaa agaagcaata attgagaata ttgagatact aaaattgtga cgagacgctt gatgggttcc acttaaatat ctgatatgat tacacgtggc agactatgct ccgtccctaa tgagcttcgt gtgattttga ttaattttgt taacttttat ttttgtcgtc tagtttttta aatttattaa ttaattttta tttatcttct aatttagatt ttattccttt aagctttttc gctcctcact ctctcttccc aaagttctct gtaaaactct ctctccgtct tcaatggttt acacgatttc aggcgtacgt tttcctcatc ttccatcgat taagaagaag aattcgtctc ttcacagttt caatgaagat ctcaggagaa gcaacgctgt ctcattctct ctgaggaagg actctcgttc ttctggtatt tgctccatct cctttgttta tatctccgtg tgtctccttc tagtggcacg ggtttcgaga ttggtgattt ccatggagtc aatgtgtggg attcaatttt tgtatcctgc ttcgtggaac attctttttt atggaggatt aatttggtgt ataattagaa tttagatggt tgatgaagtt taggagataa tgagatcttt gaggtttcgg caatgacgaa tttatacatg.......

 

usw. noch fünf mal so lang, nur dieses eine Gen.[8]

Die Buchstabenfolgen erscheinen uns zunächst ziemlich ungeordnet, wie die einer uns unbekannten Sprache bei der alle Worte ohne Lehrzeichen aneinandergereiht sind. Sie sind aber nicht ungeordnet, manchmal vielleicht. Biochemiker und ähnlich kluge Leute können die Abfolgen der Buchstaben, also der DNA-Bausteine, heute schon mit ziemlicher Geschwindigkeit entziffern und auch eine Menge Schlussfolgerungen aus der Reihenfolge ziehen, zum Beispiel: Wie viele Buchstaben ein bestimmtes Gen, also eine Erbanlage umfasst. Mal wissen sie es ziemlich genau, mal etwas weniger genau. Im Grunde ist ein Gen, oder besser, enthält ein Gen so was wie eine Basis-Information. Wenn man es mit einem richtigen Text vergleicht, dann entspricht ein Gen eher schon einer halb bis einseitigen kleinen Mini-Konstruktionsanweisung als einem einzigen Wort. Sie merken, es wird kompliziert.

Daher noch eine einfache Sache zum Abschluss dieses Beitrags. Stellen Sie sich vor der kluge Erfinder möchte die Nudelbänder verkleinern, denn essbare Anleitungen von diesem Umfang aus Nudeln wiegen Tonnen und die Bänder sind dünn aber Kilometer lang. Wie stark müsste er sie verkleinern, damit sie eine ähnliche Dicke wie die echten DNA-Bänder haben? Man sagt besser: DNA-Stränge oder -Fäden. Rechnen wir kurz: Der Nudelbuchstabe ist 5 Millimeter groß, ein DNA-Buchstabe so etwa gut 1 Nanometer (= 1nm = ein Milliardstel Meter = ein Millionstel Millimeter). Also 5 mm dividiert durch 1 nm ergibt 5.000.000. Er müsste fünf-millionenfach verkleinern. Klar, denn die Buchstaben der DNA haben nur Molekülgröße. Das ist zwar nicht mehr vorstellbar, aber einfach zu berechnen.

So dünn sind Gene. Im Verhältnis zur Dünne ist ihre Länge jedoch beträchtlich. Nehmen wir der Einfachheit halber an die Buchstaben a, c, g, t seien eher rund - also anders als die flachen Nudelbuchstaben. Dann müssen wir 1 Nanometer nur mit der Anzahl der Buchstaben multiplizieren, die ein gut halbseitiger normaler Text enthält. Das sollen hier mal 2000 sein. Also ein durchschnittliches Gen ist dann zwei Mikrometer oder ein fünf Hundertstel Millimeter lang. Das ist schon enorm lang. 50 mal länger und sie könnten es mit bloßem Auge gerade noch erkennen, wenn, ja wenn es nicht so irre dünn wäre. Aber es gibt tatsächlich Gene, die sogar 500 mal länger sind. Es gibt auch viele kürzere.

Und ganz zum Schluss zeige ich Ihnen noch, was mit fremden Genen, egal von wo sie stammen, in unserem Verdauungstrackt passiert. Alles zerfällt bis zur Unkenntlichkeit in ganz kleine Stücke: ..... t, t, gtc, t t, a, c, c, ta, at, ta, t, t,t, at, tt, a, t, tg, t, c, gt, t, tgg, t, a, a, t, a, a, t, a, aat, a, a, c, agt, tc, atg ,a, gg,....,usw, usw, usw. (wie z. B. beim Gen "sbe2.1"; s.o.). Diese Stückchen werden in unseren eigenen Stoffwechsel geschleust oder noch weiter zu anderen körpereigenen Stoffen umgebaut. Nur selten verirrt sich mal ein längeres Stück in unseren Blutkreislauf.

 

Zum Nachschauen oder zur Ergänzung:

[1] T.A. Brown. Genome und Gene. Lehrbuch der molekularen Genetik. Springer Verlag. Berlin, Heidelberg. (2007); 756 Seiten. [2] Klug, Cummings, Spencer. Genetik. Pearson Studium. (2007); 1044 Seiten. [4] oder in der deutsch Fassung DNS, ausgesprochen Des-oxi-ribo-nukle-in-säure. Lassen Sie sich von dem Wortteil "säure" nicht verwirren. Die DNS (oder DNA; engl.) ist nicht flüssig wie Essigsäure sondern ein ziemlich langes, extrem dünnes, festes, fädiges Molekül. [5] Die Seitenzahl ist natürlich frei erfunden. Merken Sie sich nur, dass es eine enorm umfangreiche Konstruktionsanweisung ist, die aus vielen dicken Aktenordnern besteht. [6] A = Adenosin-Monophosphat, C = Cytosin-Monophosphat, G = Guanosin-Monophosphat, T = Thymidin-Monophosphat. [7] Es ist der Anfang eines Gens mit Namen sbe2.1 von einem Pflänzchen namens Hirtentäschelkraut (lat. Arabidopsis thaliana); das Gen besteht aus gut 6000 solcher Buchstaben und ist Teil eines DNA-Fadens, der noch mehr als 3000 mal länger ist und tausende solcher Gene enthält. [8] Die Leerstellen nach jeweils 10 Buchstaben sind nur für's bessere Abzählen da. Eigentlich müsste man sie sich wegdenken.

 

Nicht vergessen:

► Weltweit wurden in 2013 auf 1,7 Millionen Quadratkilometer gentechnisch gezüchtete Nutzpflanzen angebaut. Beitrag 03.

► Wenn wir nicht gerade fasten, dann essen wir jeden Tag viele Milliarden fremde Gene oder - was das gleiche ist - viele Milliarden fremde Erbanlagen. Beitrag 03.

► Keine Züchtung ist so schnell und effizient wie die gentechnische, wenn nicht so viele völlig unnötige "Sicherheitsuntersuchungen" vorgeschrieben wären. Beitrag 04.

► Gentechnisch gezüchtete Pflanzen sind harmloser als normal gezüchtete!"

Beitrag 04.

 

 

06.



...effizienter, sicherer, schneller, genauer...

Gentechnik umfasst neue fantastische Methoden zur Pflanzenzüchtung, die noch einen großen Beitrag für unsere zukünftige Ernährung leisten werden. Zukunftsprognosen liegen oft falsch; meine sicherlich nicht. Denn da habe ich die Hoffnung noch nicht aufgegeben, dass sich Tatsachen auf Dauer nicht wegleugnen lassen.

Ein paar ausgefeilte und zum Entsetzen der Kritiker noch exaktere Methoden [1] wurden in den letzten paar Jahren entwickelt. Wieso werden Sie fragen, sollten denn die Kritiker jetzt entsetzt sein, die haben doch immer herumposaunt, Gentechnik sei ungenau. Ich kann es Ihnen sagen: Es fehlt denen jetzt eines ihrer Scheinargumente. Kein Bange, bei der lebhaften Fantasie, was Risiken und Gefahren anbelangt, fällt denen bestimmt was anderes ein. Und was die Genauigkeit anbelangt, so stimmte deren Behauptung höchstens für die Pflanzen, die gar nicht als Sorte freigegeben werden. Denn die Züchter haben ja immer nur solche gentechnisch veränderten Pflanzen als Sorte ausgesucht, vermehrt und angebaut, bei denen man genau wusste, wo das neue Gen, also die neue Erbanlage im Erbgut gelandet war. Die übrigen werden noch für Forschungszwecke im Labor verwendet oder man steckt sie gleich in den Dampfdruckkessel bei 120° C.

Ganz anders bei den herkömmlichen Sorten. Bei vielen weiß man noch immer nicht, was genau an welcher Stelle verändert ist!!! Vielleicht haben Sie mal von den Erbsen gehört, die der Mönch Mendel so um die 1850er Jahre in Brünn gezählt hat. Nach seinen Erbsenkreuzungen hat er die Nachkommen gezählt und scharf überlegt, was die Zahlen bedeuten könnten. Herausgekommen sind die ersten wegweisenden Vorstellungen über Erbanlagen ( = Gene) und deren Vererbung. Hätte es den Nobelpreis damals schon gegeben: Er hätte ihn bekommen. Unter anderem hatte er auch eine Sorte gekreuzt, die nur runde Erbsen produzierte, mit einer, die nur runzelige hervorbrachte. Erst 140 Jahre (!!!) später hat man herausgetüftelt, was genau den Unterschied zwischen den glatten und den runzeligen Erbsen ausmacht [3]. Die glatten Erbsen, die kamen von der ursprünglichen Erbsensorte; eben der "normalen". Wann genau die runzeligen nun entstanden sind, weiß ich nicht, sie waren aber süßer. Mindesten 140 Jahre futtert man also schon unbedarft runzelige Erbsen, ohne genau zu wissen, was da noch alles bei denen so verändert ist. Aber seinen Sie unbesorgt. So ist das bei fast allen Kultursorten bis heute, mit all ihren möglichen unterschiedlichen Eigenschaften.

Ich kann Ihnen noch verraten, worin der Unterschied der Erbsensorten besteht. Es ist ein bisschen kompliziert und sie müssen es nicht lesen; es klingt auch biochemisch oder molekulargenetisch. Eigentlich müssten Grünlinge, die ja so auf unsere Gesundheit bedacht sind, schon die ganzen Jahre laut geschrieen haben: "Oh wie gefährlich, denn nichts Genaues weiß man! Und auch noch runzelig! Was mag da nicht noch alles gefährlich verändert sein!"

Aber wenn die Erbsen süßer sind, kann's schon nicht so schlimm sein.

Hier mal die Erklärung: Da hat sich doch einfach in das Erbsen-Gen mit dem Namen "sbe I" [4] ein anderes winziges Stückchen DNA hineingesetzt. Das Gen sbeI hat mit der Bildung von Stärke zu tun, aber jetzt ist es quasi funktionsunfähig. Erinnern Sie sich noch an die Nudel-Buchstaben-Betriebs- oder Konstruktionsanweisungen aus Beitrag 05? Das ist so als würden Sie das lange Nudelband aufschneiden und irgend eine Buchstabenfolge von woanders einfügen. An der Einfügestelle ergibt die Anweisung dann keinen Sinn mehr. Damit haben wir die Frage, woher das Stückchen DNA kommt, das sich da reingequetscht hat, eigentlich schon beantwortet: Von irgendeiner anderen Stelle des Erbmaterials. Aber das ist in diesem Fall nicht irgend ein Stück. Es hat sogar einen Namen und heißt "Transposon". Ich könnte beschreiben, was ein Transposon ist. Ich könnte Ihnen jetzt noch erklären, dass das sbeI-Gen für ein Enzym mit dem Namen "SBE I = Starch branching enzyme Typ I" (Stärke verzweigendes Enzym vom Typ I) verantwortlich ist. Ich könnte Ihnen noch erklären, wie es das Gen im Zusammenwirken mit vielen anderen Zellbestandteilen bewerkstelligt, so ein Enzym herzustellen, ich könnte Ihnen versuchen zu erklären, was genau das Stärke verzweigende Enzym macht, was man unter einem Enzym versteht und warum die Erbsen süß und runzelig sind, wenn das Erbsen-Gen mit der Bezeichnung sbeI keine vernünftige Information mehr enthält. Aber das lasse ich mal lieber. Ich möchte doch nicht, dass Sie wegklicken, weil's zu kompliziert wird.

Bei der "normalen, herkömmlichen" Züchtung hat man bis in die 1950er Jahre nur sehr wenig über Gene und die Vorgänge in den Zellen gewusst und dann zunehmend immer schneller immer mehr. Wer es noch nicht weiß, heute schreiben wir das Jahr 2015. Und ausgerechnet heute gebären sich grüne Aktivisten wild und aufgeregt, wie wenig man denn überhaupt wisse. Sie schlagen Alarm, faseln von Risiken und verunsichern ihre Mitbürger und wollen Kulturpflanzen verbieten, die man mit Methoden züchtet, denen man die Bezeichnung "Gentechnik" gegeben hat. Das ist ja völlig irrational. Früher, wo man praktisch gar nichts wusste, schön still sein, Kopf in den Sand stecken und auch jetzt noch lieber mit diesen alten Methoden weiter wursteln. Heute, wo man enorm viel weiß, wollen Grünlinge modernere Züchtung verbieten, weil es zu kompliziert und daher gefährlich sein soll. Das ist nicht nur irrational, das ist schon fast schizophren. Denn alles, was in Pflanzen passiert, war schon immer höchst kompliziert und zwar genauso kompliziert wie heute und es wird auch in hundert Jahren noch genau so kompliziert sein. Der Unterschied ist: Früher wusste man wenig, heute weiß man mehr und in hundert Jahren eben noch viel viel mehr.

 

Zum Nachschauen oder zur Ergänzung:

[1] Schauen sie z.B. im Internet unter den Stichworten ZFN, TALEN, CRISPR oder Genom-Editing nach. [3] Bhattacharyyaa et al.: The wrinkled-seed character of pea described by Mendel is caused by a transposon-like insertion in a gene encoding starch-branching enzyme. Cell 60, 115 (1990). [4] Einen Teil der ACGT-Abfolge eines ganz ähnlichen Gens haben Sie schon in Beitrag 05 gesehen.

 

Nicht vergessen:

► Weltweit wurden in 2013 auf 1,7 Millionen Quadratkilometer gentechnisch gezüchtete Nutzpflanzen angebaut. Beitrag 03.

► Wenn wir nicht gerade fasten, dann essen wir jeden Tag viele Milliarden fremde Gene oder - was das gleiche ist - viele Milliarden fremde Erbanlagen. Beitrag 03.

► Keine Züchtung ist so schnell und effizient wie die gentechnische, wenn nicht so viele völlig unnötige "Sicherheitsuntersuchungen" vorgeschrieben wären. Beitrag 04.

► Gene sind dünn, lang und essbar. Je natürlicher und weniger zubereitet Fleisch, Gemüse und Obst sind, desto mehr völlig intakte Gene. Beitrag 05.

 

 

 

07.



...von radioaktiv und chemisch misshandelten Pflanzen, einem Tisch und Arbeitsteilung...

Sie haben bisher von Nudel-Buchstaben-Betriebs- und Konstruktionsanweisungen (Beitrag 05) und von radioaktiv malträtierten Pflanzen (Beitrag 04) gehört, die ich mal Mutanten-Pflanzen nennen will. Viele Gentechnik-Kritiker meinen nun allen Ernstes, das mit den malträtierten Pflanzen sei gar nicht so schlimm. Diese grässliche Strahlung und diese ekeligen Chemikalien, das sei doch natürlich. Denn so argumentieren sie, das käme ja ganz spontan in unserer wunderschönen Natur vor. Ich frage mich allerdings nur, wo? Tausendfach, zehn tausendfach schlimmer und heftiger als es die Natur schon mit uns treibt. Wissen Sie vielleicht, wo? [1]

Bei manchen dieser grünen Aktivisten hat sich in den letzten Jahren doch so was wie ein schlechtes Gefühl eingeschlichen. Bisher haben Sie nämlich solche Mutanten-Sorten fröhlich und munter und unbedarft auch im Biolandbau angebaut und in Bioläden verkauft, weil sie es nicht besser wussten oder sich nicht die Mühe machen wollten zu recherchieren oder es auch so genau gar nicht wissen wollten. Und nun winden sie sich in seltsam stillem, kaum wahrnehmbarem inneren Aktivismus, wenn's um diese Pflanzen geht. NUR bei gentechnisch gezüchteten Pflanzen, da werden sie rasend, und hauen und stechen und agitieren und demonstrieren und trampeln und pfeifen und manipulieren, japsen nach Luft und röcheln etwas von Monsterpflanzen und Frankenstein-Nahrung.

Gentechnik-Freunde, so wie ich einer bin, haben schon lange dieses merkwürdige Verhalten bemerkt. Gentechnik-Freunde können sich dieses seltsam widersprüchliche Verhalten nicht erklären oder sagen wir besser so, bevor wir unsere Vermutungen anstellen, wieso sich die Grünlinge in diesem Punkt so ungewöhnlich verhalten, werde ich versuchen Ihnen einmal die Unterschiede der Züchtungsmethoden zu vermitteln. Mutanten-Pflanzen auf der einen und Gentechnik-Pflanzen auf der anderen Seite. Seien Sie unbesorgt, diejenigen, die sich von meinen Ausführungen unterfordert fühlen, verweise ich vorsichtshalber wieder auf die anspruchsvolleren Web-Links, die Sie in Beitrag 01 finden.

Zunächst aber eine Frage, die auf den ersten Blick nichts mit Pflanzen-Gentechnik zu tun hat. Lesen Sie trotzdem ruhig mal die Antwort darauf, der Text ist nämlich leicht verständlich.

Können Sie ein Handy zusammenbauen? Ich meine nicht aus vorgefertigten Teilen zusammenstecken, ich meine wirklich von Grund auf. Ich bin mir 100% sicher: Keiner auf der ganzen Welt schafft das völlig ohne Hilfe. Auf uns allein gestellt könnten wir kein einziges der alltägliches Dinge herstellen, die wir wie selbstverständlich benutzen. Einen Spazierstock vielleicht, den wir im Wald aufsammeln, oder einen primitiven Speer. Aber wie wär's mit einem schönen Tisch. Selbst 100 beliebig zusammengewürfelte Menschen sind dazu kaum in der Lage. Sie bezweifeln das? Dann denken wir mal scharf nach. Schon bei einfachsten Möbeln wie einem Tisch oder Stuhl geraten wir in arge Not. Vier gleich lange Beine herzustellen ist ohne Säge ein Problem, also müssten wir so etwas wie ein Metallblatt, ein Messer fabrizieren, aber wie? Kaufen gilt nicht, denn ein gekauftes Messer ist nicht selbstgemacht! Damit steht zunächst einmal die eigene Eisenproduktion an. Wenn nicht gerade ein Gesteinskundler unter den 100 versammelten Menschen ist, wird es wohl kaum gelingen, das richtige Erzgestein zu erkennen. Was bliebe uns dann anderes übrig als auf archaische Weise die gesammelten dicken Äste mit scharfkantigen Steinen zu bearbeiten? Nun müssen die Beine an einer ebenen Tischplatte befestigt werden. Womit? Nägel, Schrauben, Winkel, Schraubenzieher und Bohrer kaufen gilt nicht. Wir haben das gleiche Probleme wie vorhin. Nur Selbermachen gilt! Die Resultate unserer Bemühung wären wahrhaftige "Natur-Designer"-Stücke, bei deren Anblick grüne Aktivisten in grenzenlose Verzückung geraten würden. Aber davon mal abgesehen, ist Arbeitsteilung hier das Zauberwort. Ohne Arbeitsteilung kein Wohlstand. Ohne Arbeitsteilung auch keine Computer und kein Internet mit dem man Blödsinniges über "Grüne Gentechnik" und gentechnisch gezüchtete Pflanzen verbreiten kann.

Was hat denn das mit Züchtung zu tun, werden Sie fragen. Nun, nur durch Arbeitsteilung sind wir überhaupt in der Lage bald 9 oder 10 Milliarden Menschen zu ernähren. Dazu müssen moderne Züchtung, Landwirtschaft und Nahrungsmittelproduktion in Höchstform sein. Die Verklärung archaischen Landbaus mit Grabstock oder Ochsenpflug reicht da nicht, sondern verhöhnt jene, die noch heute so schuften müssen. Wer der Natur und dem Umweltschutz viel Raum einräumen will, der muss dafür sorgen, dass eine maximale Nahrungsmittelproduktion auf der kleinst möglichen Ackerfläche erfolgt. Eine hoch produktive Landwirtschaft braucht billige Energie. Und die kann es nur geben, wenn sie im Überfluss angeboten wird. Je weniger Platz wir für die Energiegewinnung verbrauchen, desto besser für Natur- und Umweltschutz. Alles was uns helfen kann, Verluste bei der Nahrungsmittelproduktion so gering wie möglich zu halten, muss willkommen sein: Auch gentechnisch gezüchtet Pflanzen müssen dazu beitragen können. Aber was machen grüne Aktivisten? Sie plädieren für eine "ökologische Landwirtschaft" die mindestens 50% mehr an Ackerfläche verbraucht als herkömmliche Landwirtschaft. Sie errichten überall Windmühlen, die bezogen auf die Energiegewinnung nach meiner Information mehr Fläche und Material verbrauchen als herkömmliche Kraftwerke und sie verbreiten seit mehr als 30 Jahren Misstrauen: "Gentechnisch gezüchtete Kultursorten seien ein Risiko für Tier, Mensch und Umwelt und würden irgend wann einmal Fürchterliches anrichten. Keiner könne das ausschließen."

Das ließe sich aber genau so von mit alten Methoden gezüchteten Pflanzensorten behaupten. Keiner kann ausschließen, dass nicht irgend wann eine Mutanten-Pflanzensorte die Welt bedroht.

Gefährlich sollen sie also sein, die gentechnisch modifizierten Sorten!? Gefährlich? Gefährlich im Vergleich zu was?

Sinnvollerweise vergleichen wir gentechnisch gezüchtete Sorten einfach mal mit herkömmlichen Sorten! Nun sind moderne Züchtungsmethoden leider äußerst kompliziert, auch die von "herkömmlichen" Sorten. Für die meisten von uns sind Züchtungsmethoden ein Buch mit sieben Siegeln. Kaum ein Gärtner oder Landwirt ist in der Lage selbst Hochleistungssorten zu züchten und sie dann auch noch in großem Maßstab anzubauen. Arbeitsteilung ist auch hier das Zauberwort. Erst durch Arbeitsteilung können wir genug gute, preislich erschwingliche Nahrung produzieren. Forschungsinstitute, Forschungsabteilungen der Industrie und viele Saatgutfirmen züchten, entwickeln und verbessern. Landwirte nehmen das Saatgut, das ihnen am Besten erscheint, und treiben Landwirtschaft mit den Methoden von denen sie glauben und hoffen, ihren Lebensunterhalt am Besten bestreiten zu können. So sollte es sein. In Europa tut man sich schwer, die Dinge so zu handhaben. Nach dieser trockenen Einleitung nähern wir uns endlich dem, auf das Sie sicherlich schon sehnsüchtig gewartet haben: Radioaktive Strahlung und mutagene Gifte. Das ist doch mal was richtig Schauriges.

Aber ein winziges bisschen Geduld müssen sie noch aufbringen. Erbmaterial und die Betriebs- oder Konstruktionsanweisungen aus Nudel-Buchstaben-Bändern haben Sie ja schon in Beitrag 05 kennengelernt. Eine kurze Wiederholung und eine leichte Abänderung unseres Beispiels kann daher nicht schaden:

Das Erbmaterials enthält Information, ähnlich wie die Buchstabenfolge eines Textes in einer vielbändigen Betriebsanweisung. Nun ist wieder Ihre Fantasie gefragt: Stellen wir uns den ganzen Text der Betriebsanweisung in Form von Papierbändern vor; als zusammengesetzt aus mehreren enorm langen, einigermaßen reißfesten nur einzeilig bedruckten Papierbändern. Ein bisschen schwer zu handhaben; besonders das Nachschlagen wird zu einer Geduldsprobe; aber vielleicht doch noch handlicher als im Nudel-Beispiel.

Die Buchstaben würden dann verschiedenen Molekül-Grundbausteinen a, c, g und t des Erbmaterials entsprechen und die Papierschlangen den langen DNA-Molekül-Fäden, zu denen die Grundbausteine in den Zellen der Lebewesen verknüpft sind.

Wie groß müsste die Zahl der Buchstaben und die Länge dieser Luftschlangen sein, um uns eine Vorstellung von der Zahl der winzigen Erb-Bausteine und der Länge der extrem dünnen Erb-Fäden jeder einzelnen Pflanzenzelle zu vermitteln? Riesig.

Rechnen wir mal wieder: Unsere Original-Anleitung aus Papier bestünde dann aus 50 Bänden mit unterschiedlichem Text. Jeder dieser verschiedenen Bände ist mit 10.000 Seiten enorm dick und eng bedruckt, eine Seite hat 60 Zeilen, eine Zeile 16 Wörter und ein Wort im Durchschnitt 5 Buchstaben. Jeder Band enthält daher knapp 50 Millionen Buchstaben (berechnet aus 10.000 x 60 x 16 x 5). Um den ganzen Text eines einzigen Bandes einzeilig auf einen Streifen drucken zu können, müsste der Streifen etwa 125 km lang sein, wenn wir eine Buchzeilenlänge von 20 cm zugrunde legen. Ich hoffe, ich habe mich nicht verrechnet und Sie nicht verwirrt.

Aber, das ist schon alles, was wir uns vorstellen müssen, um uns im folgenden Abschnitt den Unterschied zwischen gentechnischer Züchtung und herkömmlicher Mutantenzüchtung klar machen zu können. Wir packen nun je eine komplette Anleitung bestehend aus 50 Streifen (was den 50 Bänden entspricht) von je 125 km Länge in einer fensterlosen dunklen Halle in drei Zellen ohne Licht. Jeder der Räume enthält dann insgesamt gut 6000 km "Streifensalat". Raum 1 ist für den Gentechniker (Methode 1) bestimmt, Raum 2 für die Mutantenzüchtung (Methode 2). Der 3. Raum ist sozusagen für die Pflanzenzüchtung bestimmt, wo nicht der Züchter, sondern die Natur selbst herumgewurstelt hat; wenn Sie wollen unser "Standard-Vergleichsraum" (Methode 3).

Nun betrachten wir uns anschaulich die Arbeitsweise vom Gentechniker und vom "Mutanten"-Züchter.

Der Gentechniker stellt im Labor zunächst einen Textstreifen her von - sagen wir mal - gut 20 Meter Länge, auf den hat er eine zusätzliche sinnvolle Anweisung geschrieben, mit knapp 10.000 Buchstaben. Er geht nun - ohne Lampe, ohne Licht - in Raum Nr. 1 und versucht im Stockdunkeln seinen vorgefertigten Streifen zusätzlich irgendwo in den 6000 km-Streifensalat mit Schere und Kleber einzufügen. Wo er diesen Streifen genau eingefügt hat, kann er zunächst noch nicht sagen; wohl aber zu einem späteren Zeitpunkt des Züchtungsablaufs.

Und nun die Arbeit eines "Mutanten"-Züchters, so wie es sich bei etwa einem Drittel unserer heutigen herkömmlichen Kulturpflanzen - ich will sie Mutanten-Pflanzen nennen - zugetragen hat: Der Züchter geht ohne Extra-Streifen nur mit Schere, Kleber und Stift bewaffnet in Raum Nr. 2. Auch er muss im Dunkeln arbeiten und kann nichts sehen. Er fängt an wild irgendwo herumzuschneiden, um die Enden dann zufällig zusammenzukleben. Er versucht Buchstaben, so wie sie ihm gerade einfallen, irgendwo auf das Textband zu schreiben. Schreiben, schneiden, kleben an hunderten oder tausenden von Stellen ohne sich Notizen zu machen. Was er da innerhalb von - sagen wir - etwa 30.000 Sekunden (das entspricht einem Arbeitstag von zirka acht Stunden) angestellt hat, wo genau, an wie vielen Stellen er was verändert, gedreht, versetzt, ausgeschnitten oder überschrieben hat, kann er nicht sagen. Im späteren Verlauf der Züchtung gelingt es ihm vielleicht - wenn überhaupt - dann auch nur bei einigen wenigen Stellen festzustellen, was verändert ist.

Nun zu Raum 3. Sie würden vielleicht erwarten, dass hier gar nichts passiert, ähnlich wie bei einem Buch, das herumliegt, da verändern sich ja spontan auch keine Buchstaben. Aber die Natur verändert nun mal am Erbmaterial der Lebewesen immer und überall ein bisschen. Daher müssen wir in unserem Beispiel Natur "simulieren". Dazu schicken wir jemanden auch in die dunkle Kammer zum Scheiden, Kleben und Überschreiben, aber nur für etwa 30 Sekunden. Dann rufen wir ihn wieder heraus, so dass er nur an sehr wenigen Stellen Veränderungen vornehmen konnte; eben so, wie es "natürlicherweise" überall in der Natur zu allen Zeiten passiert und so wie es sich bei etwa zwei Drittel unserer Kulturpflanzen abgespielt hat. Nur 30 Sekunden hat er was verändern können, im Vergleich zu 30.000 (!) Sekunden in Raum 2. Aber für Raum 3 gilt: Was die Natur da angestellt hat, wo genau, was verändert, gedreht, versetzt, überschrieben wurde, kann man nicht sagen; später vielleicht, aber auch nur für einzelne wenige Stellen. So, das waren sie nun: DIE ENTSCHEIDENDEN UNTERSCHIEDE zwischen gentechnischer Züchtung (Punkt 1) und "Mutanten"-Züchtung (Punkt 2) und der natürlichen Situation (Punkt 3) [2].

Und noch was: Die dunklen Räume sollen jeweils eine Pflanzenzelle darstellen. Und natürlich verkleinern wir nicht den Züchter, damit er in die Pflanzenzellen hineinkriecht, sondern Schreib-, Schneide- und Klebeaktionen versuchen wir irgendwie von außen vorzunehmen. Dabei kann kein Züchter sehen, was in diesen Momenten in der Zelle passiert, auch nicht im Mikroskop.

Und noch was sollte ich erwähnen: Es ist nicht nur eine Zelle, die mit der jeweiligen Methode malträtiert wird, sondern es sind gleichzeitig tausende, ja hunderttausende bei jedem einzelnen Züchtungsgang.

Jetzt meine suggestive Frage: Welche Züchtungsmethode scheint Ihnen die gefährlichste zu sein?

Ein grüner Aktivist wird nun Stein und Bein schwören, es sei die gentechnische Methode, denn da hat der Züchter was völlig Neues ins Erbgut reingeklebt, was völlig Unnatürliches, was potentiell Gefährliches. Sagen sie das mal einem Autohersteller, der seine Automodelle nach bestem Wissen verbessert hat und entsprechend die Konstruktionsanweisung verändern musste. Das nur als kleine Anregung zum Nachdenken.

Meine Gegenfrage an den Aktivisten: "Glauben Sie wirklich, der Züchter hat nicht sehr sorgfältig darauf geachtet, dass das Neue nicht schadet? Glauben Sie wirklich, er hat sich keinerlei Rat bei anderen Experten eingeholt, sondern hat ganz allein im Kämmerlein gewerkelt und irgend eine schlimme Information auf sein 20 Meter langes Papierband geschrieben?" Nein, Teamarbeit und Arbeitsteilung ist dabei gefragt. Züchter sind daran interessiert, dass die neue Sorte dickere Körner hat oder schnelleres Wachstum zeigt oder besser schmeckt oder besser gelagert werden kann oder die Ernte leichter ist, die Reifung gleichmäßiger erfolgt, Trockenheit besser verkraftet wird. Der Verbesserungsmöglichkeiten gibt's da sehr viele. Und schließlich sollen alle damit zufrieden sein, der Landwirt und die Konsumenten. Ich will an dieser Stelle nicht auf weitere Einwände von Grünlingen eingehen, vielleicht später im Blog, denn wir wollen ja mit unserem Züchtungsvergleich weitermachen.

Im weiteren Züchtungsablauf der Sorten gibt es zwischen den herkömmlichen und gentechnisch veränderten im Prinzip KEINE besonderen Unterschiede.

Nach der Behandlung muss man die Zellen, Pflanzenteile oder Samen erst mal hochpäppeln und hoffen, dass einige überlebt haben; besonders bei Methode 2, aber auch bei Methode 1 muss man hoffen.

Methode 3 ist weniger kritisch, da das Malträtieren immer und überall in der Natur so ein bisschen vorkommt und man muss da auch meist nicht hochpäppeln, weil es sich um "normale" Vermehrung über "normalen" Samen handelt. Der Züchter schaut nur sehr genau hin, ob vielleicht irgendwas zufällig zum Besseren verändert ist.

Also hochpäppeln. Die Zellen sollen sich vermehren und aus den Zellklümpchen oder den behandelten Samen sollen neue Pflänzchen entstehen. Dann heißt es: Weitervermehren und gucken und testen, ob nicht das eine oder andere mit der gewünschten Eigenschaft dabei ist, aus dem man eine neue Sorte entwickeln kann. Ja, ich weiß, ganz so einfach geht's nicht, aber vom Prinzip geht's so. [2]

Also nochmal: Im weiteren Verlauf des Züchtungsverfahren KEINE besonderen Unterschiede, speziell zwischen Methode 1, mit der wir eine neue Gentechnik-Sorte erhalten und Methode 2, die uns eine neue Mutanten-Sorte beschert.

Bevor noch mehr unberechtigte Einwände kommen, schnell die neue Sorte im Gewächshaus vermehren, die Nachkommen im Probeanbau auf dem Feld testen und dann die Sorte mit Sortenschutz oder Patentschutz versehen. Wieso auch nicht? Schließlich will man ja irgendwann mal an der neuen Sorte verdienen und nicht nur Geld reinstecken. Wer arbeitet schon gern umsonst? Das machen nur die Ökobauern und Biolandwirte. Deshalb sind die Bioprodukte ja auch meist teurer.

Oh, je. Ich habe vorhin absichtlich nicht die ganze Wahrheit gesagt: Ja, es gibt EINEN Unterschied zwischen Mutanten-Sorten und gentechnischen Sorten. Die haben aber mit dem eigentlichen Züchtungsverlauf rein gar nichts mehr zu tun:

Gentechnisch veränderte Sorten (Methode 1) werden getestet, getestet, getestet und getestet und untersucht und untersucht und untersucht und..... Wenn's nach den grünlichen Aktivisten ginge, würden alle diese Sorten mindestens noch die nächsten 100 Jahre getestet. Sie werden nach allen Regeln der Kunst getestet: Biochemisch, physiologisch, sicherheitsrelevant, umweltrelevant. Und man hat sogar schon längst vorher nachgesehen, wo das kleine Extrastück im Erbgut steckt, und klar hat man auch nur die Pflänzchen genommen, wo das Stückchen, nach allem was man weiß - und das ist schon ziemlich viel-, keinen Schaden für die Pflanze und auch sonst nicht anrichten kann. Man wäre ja schön blöd, wenn man aus einer ungeeigneten Pflanze eine neue Sorte entwickelte. Diese letztere Bemerkung nur, um den entsprechenden Einwand von Grünlingen sofort zu entkräften, bei dem selbst die monoton klappernde Bartaufwickelmaschine ihre Augen verdrehen würde, hätte sie welche. Und das ist noch nicht mal ein Witz.

Der Witz kommt jetzt: Sie dürfen raten, was für die Mutanten-Sorten aus herkömmlicher Züchtung (Methode 2) an "Sicherheitsuntersuchungen" vorgeschrieben ist: Nichts! Aber auch gar Nichts! NICHTS! Absolut NICHTS!!! Natürlich gilt das auch für Methode 3, wo ja auch was Unbekanntes auf ganz natürliche Weise verändert sein könnte. Aber wissen braucht man NICHTS und Grünlinge möchten's auch nicht wissen, denn sonst bekämen sie vielleicht ein schlechtes Gewissen. Begründet wird das NICHTS bezüglich Testen mit der lapidaren Behauptung: Es ist ja "natürlich". Wissen Sie wie viele Gifte "natürlich" sind? Wenn nicht dann schauen Sie doch einfach mal im Internet unter "natürliche Gifte" nach.

Richtige Züchter sind auch bei herkömmlich gezüchteten Sorten daran interessiert herauszubekommen, wo im Erbgut noch etwas verändert sein könnte. Und die Technik ist seit ein paar Jahren auch so weit, dass man es sogar herausfinden kann.

Gut, wenn ich die neue "natürliche" Mutantensorte mit einem Sortenschutz versehen möchte, dann muss ich erklären, was jetzt so besonderes neues Gutes an meiner Sorte ist, und dazu ein paar Daten vorlegen. Aber nach eventuell Schlechtem bräuchte ich nicht zu suchen. Ein Öko-Mensch, der in seinem Biogarten irgendwas Neues heranzieht, kann's in seinem Bioladen verkaufen. Machen Sie das mal mit einem gentechnisch gezüchteten Pflänzchen, dann landen Sie im Knast. Jedesmal wenn ich darüber nachdenke, dann .... nein, ich verdränge es lieber.

 

Jetzt noch ein paar nüchterne Sätze, ohne große Erklärungen, die allgemein für Kultursorten gelten, egal ob mit oder ohne Gentechnik:

 

Monokulturen gibt und gab es nicht nur mit gentechnischen Sorten, sondern auch mit herkömmlich gezüchteten Sorten.

Gentechnische Sorten könnte man ohne weiteres auch ökologisch und nachhaltig anbauen, aber da weigern sich die Grünlinge, weil sie fürchterliche Angst haben, gentechnische Sorten könnten irgendwas verunreinigen. Aber womit nur?

► Herkömmliche Sorten wurden 2013 auf knapp 90% der Ackerfläche angebaut, gentechnisch gezüchtete Sorten auf etwa 10%, Tendenz steigend. Nein, nicht auf Europa bezogen, sondern auf die ganze Welt. Ökologischer Anbau findet auf 1% statt.

Jeder Landwirt ist frei in der Wahl seiner Sorten, die er anbaut und der Wahl der Firmen, von denen er Saatgut kauft. Nein, nicht in Europa, aber in vielen Teilen der Welt.

Muss ich meine Frage nach der sichereren Züchtungsmethode immer noch suggestiv stellen?

Falls Sie immer noch zur grünen Aktivistenmeinung tendieren und glauben Mutanten-Methode 2 sei besser oder auch 3, die langsamste der Methoden, und Gentechnik-Methode 1 sei Teufelszeug, dann habe ich noch ein anderes Beispiel.

Wenn Sie aber schon erleichtert aufatmen und Methode 1 gar nicht mehr so schlimm finden, dann vergnügen Sie sich doch einfach anderweitig. Ein bisschen mehr Lebenslust kann sicher nicht schaden.

Machen wir erst mal eine Pause: Für die einen, um sich des Lebens zu erfreuen, in der beruhigenden Tatsache, dass es Techniker, Naturwissenschaftler und auch Pflanzenzüchter gibt, die unermüdlich tüfteln, um Neues herauszubekommen. Was uns ja im Großen und Ganzen in den letzten 200 Jahren und insbesondere in den letzten Jahrzehnten eine nie dagewesen Unabhängigkeit von den Unbilden der Natur verschafft hat.

Für die anderen, um Zeit zu haben sich zusammen zu hocken, um noch mehr Haare in der Suppe unserer Gesellschaft zu finden.

 

Zum Nachschauen oder zur Ergänzung:

[1] Auch, da fällt mir gerade ein: Radioaktivität ist auch natürlich. Und nun schauen Sie mal genau hin, was Grünlinge über Radioaktivität sagen, die wir in unseren Kernkraftwerken zur Energieerzeugung verwenden!!! [2] Um es nicht zu kompliziert zu machen, habe ich die Züchtungs-Kreuzungen hier einfach mal weggelassen. Kreuzen von Sorten untereinander kommt meist bei allen Methoden noch dazu. Als ganz grobe Faustregel: Praktisch immer bei Methode 3, sehr oft bei Methode 2 und manchmal bei Methode 1. Und um noch genauer zu sein: Diese 30 Sekunden "Natursimulation" finden immer zusätzlich auch bei Methode 1 und 2 statt.

 

Nicht vergessen:

► Keine Züchtung ist so schnell und effizient wie die gentechnische, wenn nicht so viele völlig unnötige "Sicherheitsuntersuchungen" vorgeschrieben wären. Beitrag 04. ► Gene sind dünn, lang und essbar. Je natürlicher und weniger zubereitet Fleisch, Gemüse und Obst sind, desto mehr völlig intakte Gene. Beitrag 05.

► Bei den meisten althergebrachten Sorten weiß man bis heute nicht genau, was noch so alles verändert ist. Beitrag 06.

 

 

 

08.



...gefährlich! Im Vergleich zu was?...

 

Was kann denn schon Schlimmes an ganz normaler Züchtung sein? Eigentlich nichts. Da bin ich sogar mit den Grünlingen mal einer Meinung. Auch wenn die Mutanten-Züchtung undefinierter, unberechenbarer, unsicherer, unerforschter ist, im Vergleich zur gentechnischen; wie Sie es vielleicht schon mitbekommen haben. Gerade auch wenn man die ganze Entwicklung der Züchtungsmethoden im Rückblick betrachtet.

Im Folgenden kommt ein weiteres anschauliches Beispiel. Diesmal mit mehr Details, wie das Erbgut durch die Natur (Methode 3 in Beitrag 07) und rabiate Behandlung durch den Züchter (Methode 2 in Beitrag 07) verändert wird. Keine Sorge, auch wenn das Beispiel etwas merkwürdig scheint, den Text kann jeder verstehen.

Grünling mögen jetzt verächtlich geifern, ich sei naiv, das Beispiel sei an den Haaren herbeigezogen, ich sei ein Lobbyist der Agro-Gentechnik. Lassen Sie sich nicht davon beeinflussen, sondern behalten Sie einen klaren Kopf.

Wer nun ganz neugierig auf das Beispiel ist, dem sei gesagt es fängt ein paar Absätze weiter unten an; zuvor noch ein paar trockene Erläuterungen.

Wenn's um Gefährlichkeit geht, hier wieder die Frage, die sich jeder immer stellen sollte: Gefährlich? Im Vergleich zu was?

Im Vergleich zum Straßenverkehr, im Vergleich zum Kohleabbau, im Vergleich zu Handystrahlung, im Vergleich zu Konzentrationen von Unkrautvernichtungsmittel und Insektengiften, deren erlaubte Grenzwerte noch 100- bis 1000-fach niedriger liegen, als die Konzentrationen bei denen man überhaupt erst beginnt, minimale Effekte zu erkennen. Oder gefährlich im Vergleich zu mit Pilzgift beladenen oder bakterienverseuchten Bio-Nahrungsmittel bei denen reihenweise Leute erkranken und manchmal sterben? Das letzte sollte ironisch sein; ist aber eigentlich nicht zum Lachen [6].

Ich würde vorschlagen: Wir vergleichen herkömmliche Mutanten-Kulturpflanzen oder auch ganz normal entstandene Sorten mit gentechnisch veränderten Sorten, wie wir es in Beitrag 07 schon vorexerziert haben.

Betriebsanweisungen braucht man für den reibungslosen Ablauf in Firmen und Betrieben. Sie enthalten auch Verhaltensregeln für besondere Vorkommnisse und für Störfälle. Eine Betriebsanweisung ist nichts statisches. Firmenleiter möchten manchmal Prozessabläufe oder anderes optimieren. Dann werden Teile der Betriebsanweisung eben umgeschrieben. Das geht verhältnismäßig einfach.

Wollen wir jedoch Pflanzen etwas beibringen, was uns, den Landwirten, den Konsumenten, der Umwelt nützt, dann ist das schon erheblich schwieriger. Wir müssen Teile der Betriebsanweisungen verändern. Wo stecken nun diese pflanzlichen Betriebsanweisungen? Das allermeiste davon steckt in den Genen, also den Erbanlagen. Das wiederum sind Abschnitte auf den extrem langen DNA-Fäden. Die DNA-Fäden ihrerseits sind verpackt in den Chromosomen. Die wiederum stecken im Zellkern und der steckt in der Zelle. Alle Zellen zusammen schön fein geordnet, laufen als Mensch, Katze, Amsel, Biene, kurz als Tier durch die Gegend oder sie stehen meist fein still herum als Weizen, Apfelbaum, Karotte, Banane, eben als Pflanze und warten nur darauf, dass wir sie nutzen - im besten Fall als Nahrung.

Dazu haben wir seit 10.000 Jahren und mehr, die bekömmlichsten ausgesucht; nicht nur gleich heruntergeschlungen, sondern auch gehegt und vermehrt. Lange war auch den Ackerbautreibenden schon klar: Durch Kreuzen kann man Besseres erhalten.

Seit etwa 1900 wurde dann gezielt gekreuzt, da kluge Leute [1] Regeln erkannten, nach denen Vererbung funktioniert. Seit etwa 1930 ging es mit der Züchtung im Schnellgang weiter, weil kluge Leute [2] herausfanden, wie man Veränderungen (Mutationen) und damit genetische Vielfalt schneller erzeugen kann. Und schließlich wurde mit Gentechnik seit etwa 1985 der Züchtungsturbogang eingelegt.

 Aber gehen wir zurück zum allseits akzeptierten Züchtungsschnellgang mit radioaktiven Strahlen (!) und toxischen, mutagenen Chemikalien (!), deren Wirkung ich Ihnen schon in Beitrag 07 (Methode 2) anschaulich näher gebracht habe.

Damit kann man die Betriebs- und Konstruktionsanweisungen bei Pflanzen verändern; 1000-fach, 10.000-fach effizienter gegenüber dem, was die Natur so natürlicherweise zustande bringt. Die Natur bringt nun zufällig meist Schädliches hervor und selten was Besseres. Wenn man Strahlung und Chemikalien einsetzt, dann gibt es zwar 10.000 mal mehr Blödsinniges, Unverträgliches und sogar Giftiges aber auch öfter (!) mal was Besseres. Sucht der Züchter nun eine ihm gut erscheinende Sorte aus, weiß er absolut nicht, ob sich nicht nebenbei ganz unbemerkt auch was Unbekömmliches oder gar Giftiges eingeschlichen hat. Wo sollte er auch suchen? Es gibt zehntausende Gene mit denen was passiert sein könnte. Und Suchmethoden mit denen man es systematisch hätte angehen können, gibt's erst seit wenigen Jahren. Risiko und Gefahr lauern also schon seit Urzeiten in neuen Sorten. Besonders bedrohlich lauern sie nun schon seit mehr als 80 Jahren. Und wir, ja sogar Grünlinge futtern alles unbekümmert, weil sie sich einreden, es sei natürlich. Wer sich über die Mutanten-Methode noch ein bisschen gruseln möchte, dem kann ich nur wärmstens den Beitrag vom amerikanischen Züchter und Molekularbiologen Kevin M. Folta empfehlen: [3].

Ich behaupte jetzt einfach mal, nach grüner Agitatoren-Art: Keine der herkömmlichen Sorten darf mehr angebaut werden; wer sich nicht dran hält, dem trampeln wir auf dem Acker herum. Und wer die verkauft, bei dem stellen wir uns mit Transparenten auf. Denn, wie wir gerade gelesen haben, ist das ein unfreiwilliges Experiment mit uns allen. Erst müssen alle Sorten jahrzehntelang getestet werden. Sie müssen sofort gekennzeichnet werden, damit wir die freie Wahl haben, denn: Jede neue ökologische oder herkömmliche Pflanzensorte könnte toxische Peptide produzieren, also giftige kleine Proteine oder noch anders ausgedrückt, giftige kleine Eiweißmoleküle [8]. Wie das?

Nach diesem langatmigen Vorlauf sollen Sie endlich Ihr Beispiel bekommen.

Nehmen wir die Papierstreifen von Beitrag 07. Diesmal sollen sie der Einfachheit halber erheblich kürzer sein. Auf so einen Papierstreifen schreiben wir einzeilig einen kurzen Text. Dabei steht uns nur ein kleiner Wortschatz mit kryptischem Satzbau und kryptischer Grammatik zur Verfügung.

In den Zellen der Lebewesen ist das natürlich ganz anders. Da gelingt es mit vier Buchstaben (a, c, g, t) und einem ähnlichen kargen Satzbau wie hier im Beispiel in wunderbarer Weise, die Information für zehntausende verschiedener Eiweißsorten zu hinterlegen, die meisten davon lebenswichtig für Pflanzen, Tier und Mensch.

Aber zurück zum Papierstreifen. Der soll folgenden Text enthalten:

"emma eva nora lieb reiz burg lager bier pils leo tim aron gras vitaler esel reh".

Mit etwas Fantasie klingt das vielleicht wie eine nette Idylle mit folgenden Sinn: Emma, Eva und Nora waren liebreizend anzusehen. Leo, Tim und Aron tranken im Lager auf der Burg Bier, und zwar Pils. Im Gras steht ein vitaler Esel und in der Ferne ist ein Reh zu sehen.

Bevor Sie sich an die Stirn fassen und sich fragen, "was soll denn der Quatsch", schneiden wir schnell das Textband in der Mitte an zwei Stellen auf, z.B. hinter "nora" und "gras", drehen das mittlere Stück um und kleben es wieder ein [4]. Abgesehen davon, dass die Schrift jetzt auf dem Kopf steht, versuchen wir wieder von links nach rechts zu lesen. Und was lesen wir da:

"emma eva nora / sarg nora mit oel slip reib regal grub zier beil / vitaler esel reh.

Wir lesen die Buchstaben im Mittelteil des Textes rückwärts. Und, obwohl rückwärts gelesen, stehen da wieder richtige Worte [5], nur der Sinn ist verändert: Vielleicht sollen ja jetzt Emma und Eva, die mit Öl eingeriebene und mit einem Slip bekleidete Nora in den Sarg legen, nachdem sie aus dem Regal das Beil genommen und damit den vitalen Esel und das Reh erschlagen haben. Ihnen fällt bestimmt noch Fantasievolleres ein und können dabei auch "grub" und "zier" verwenden.

Nehmen wir nur mal "gras" und "lieb". Umgedreht, von hinten nach vorn gelesen wird daraus "sarg" und "beil". Aus Worten, die wir mit Angenehmen verbinden, werden solche, die eher beängstigen. Das ist genau der Punkt, den ich Ihnen mit dieser Analogie vermitteln will. Auf's Pflanzenerbgut angewendet könnte ich so formulieren: Verdrehungen im Erbgut, wie sie bei Methode 2 und selbst bei althergebrachter Züchtung (!!!, also Methode 3), auftreten können, könnten die Bildung gefährlicher Eiweißstoffe, sprich toxischer Peptide, zur Folge haben.

Knifflig war es schon, die Worte für dieses Beispiel zusammen zu stellen, damit es einigermaßen anschaulich ist und funktioniert. Im Erbgut von Pflanze ist das wesentlich einfacher. Umgedrehte Erbgutstücke, umgedrehte Gene oder auch umgedrehte Teile von Genen können im Prinzip rückwärts gelesen zur Bildung neuer, anormaler, kleiner Eiweiße führen, die bis zu diesem Zeitpunkt noch nie in der Pflanze gebildet wurden [7]. Ich würde sie einfach mal als "fremde" oder auch als quasi "artfremde" Peptide bezeichnen. Aber nicht nur Umdrehen (Inversion), auch Ausschneiden (Deletion) und Einfügen (Insertion) kann ähnlich "gefährlich" sein. Gucken sie einfach mal im Internet unter dem Stichwort Leserastermutation (engl.: Frameshift) nach. Es gibt noch andere Möglichkeiten, wie Versetzen (Translokation) und Verdoppeln (Duplikation). Sie meinen, das Ganze ist ein faules Argument von Gentechnik-Lobbyisten, so wie ich einer bin? Bitte, dann schlagen Sie ruhig in älteren Genetikbüchern nach, die vor 1974 erschienen sind. Da gab es nämlich noch keine Gentechnik.

Wenn die umgedrehten Stücke klein sind und/oder die Eiweiß-Moleküle nur in wenigen Exemplaren vorliegen, fällt das keinem Züchter auf. Obwohl diese "Gefahr" nun seit über 50 Jahren bekannt ist, hat kein Grünling vor den "möglichen Risiken" durch derart veränderte "Öko"-Pflanzen gewarnt. Selbst jetzt, wo es seit ein paar Jahren mit neuen Methoden durchaus möglich wäre, nach solchen Veränderungen zu suchen, schweigt man fein still. Nichts wird bei "normaler" Züchtung geprüft. Keiner schert sich darum. Welch ein widersinniger Kontrast zum Schreckgespenst, das Aktivisten überdimensioniert aufblasen, wenn es sich um gentechnisch gezüchtete Sorten handelt. Wie widersinnig ist es da, unter der Devise "Feldbefreiung", kriminellen Vandalismus gut zu heißen, gegen Felder auf denen hoffnungsvoll die ersten Generationen von "Zukunftspflanzen" heranreifen. Es ist einfach schizophren, sich bei "Genpflanzen" (Beitrag 07, Methode 1) vor Angst in die Hose zu machen oder gegen sie zu hetzen, aber beim weit größeren Risiko mit ungetesteten Mutanten-Pflanzen im Öko-Anbau (Methode 2 und 3) ins Schwärmen zu geraten.

Blicken wir nochmal zurück auf diese riesig langen Papierstreifen in Beitrag 07, mit zehntausenden von sinnvollen Wörtern der Betriebsanweisung. Da gibt es unzählige Möglichkeiten Wortteile, Wörter und Wortgruppen umzudrehen, an andere Stellen zu setzen, zu verdoppeln oder herauszuschneiden. Danach wird der Sinn in den meisten Fällen an den betroffenen Stellen verändert sein.

Wie der Gentechniker vorgeht, haben wir bei Methode 1 (Beitrag 07) erwähnt, er fügt eine zusätzliche Anleitung ein, deren Sinn er im Wesentlichen kennt. Später im weiteren Züchtungsverlauf schaut er nach, ob sie an einer Stelle im Erbgut platziert ist, wo sie nach dem letzten Kenntnisstand der Wissenschaft keinen Schaden anrichtet, sondern uns nützt. Vergleichen Sie das mit Situation (2) und (3), die von Grünlingen seit Jahrzehnten stillschweigend hingenommen wird, mit der scheinheiligen Rechtfertigung: Es ist ja "natürlich".

Immer noch nicht überzeugt, dass Methode 1 (Beitrag 07) wesentlich sicherer ist? Dann gibt’s drei Möglichkeiten: Sie lesen erst gar nicht weiter, sollten Sie überhaupt bis hierher gekommen sein und hängen weiter Ihrem falschen Glauben an, den Sie sich haben aufschwatzen lassen, von pseudo-wissenschaftlichen selbsternannten Experten und unkritischen Medien, denen es lieber ist Angstszenarien zu verbreiten, um die Auflagen zu steigern, als Fakten objektiv zu werten und zu vermitteln. Oder Sie beginnen ein Studium und versuchen, sich Kenntnisse in Molekularbiologie und moderner Züchtungsforschung anzueignen. Sie könnten aber zunächst auch einfach weiterlesen.

Im nächsten Beitrag 09 werde ich Ihnen in zwei Tabellen die Unterschiede von gentechnischer Züchtung, Mutanten-Züchtung und "natürlicher" Züchtung noch einmal auflisten.

 

Zum Nachschauen oder zur Ergänzung:

[1] wie Mendel, Correns, Tschermak, und DeVries. [2] Muller, HJ, Science 66, 84 (1927) und Auerbach, Oehlkers, Rappoport in den 1940er Jahren. [3] Prof. Kevin M. Folta, University of Florida.: //www.hos.ufl.edu/faculty/kmfolta und www.novo-argumente.com/artikel/atomares_gaertnern_die_ultimativen_frankenstein_pflanzen. [4] Ganz so, wie es besonders bei und nach radioaktiver Bestrahlung mit den DNA-Fäden (also dem Erbmaterial) in den Zellen passieren kann. [5] Worte oder Sätze, die vor- und rückwärts gelesen einen Sinn ergeben, sind eine besondere Form von "Palindromen". [6] sehen Sie mal nach unter: EHEC-Epidemie, 2011. [7] Wer es genauer wissen will, der kann sich ja mal Beitrag 13 ansehen. [8] und natürlich auch noch anderes Schlimmes.

 

Nicht vergessen:

► Gene sind dünn, lang und essbar. Je natürlicher und weniger zubereit Nahrung ist, desto mehr völlig intakte Gene. Beitrag 05.

► Bei den meisten althergebrachten Sorten weiß man bis heute nicht, was genau so alles verändert ist. Beitrag 06.

► Bei Mutantenzüchtung (aber auch bei Kreuzungszüchtung) entsteht eine unübersehbare Vielzahl an Nachkommen; nicht so bei der gentechnischen Züchtung. Mutantenzüchtung erweitert aber erfolgreich die "natürliche" Auslese-Züchtung. Beitrag 07.

 

 

 

09.

...öde Tabellen und eine Zugabe...

Dieser Beitrag beisteht nur aus zwei Tabellen mit einem Vergleich von Züchtungsmethoden. Etwas langweilig, etwas trocken, etwas nüchtern. Und weil Tabellen eben so sind, habe ich zunächst eine kleine interessante Berechnung meinerseits für Sie als Zugabe eingefügt. Wenn Ihnen das alles trotz der guten Übersichtlichkeit zu öde ist, dann müssen Sie leider auf Beitrag 10 warten. (Mittlerweile gibt es auch Beitrag 15, wo drei der grünlichen Behauptungen in lockerer Dialogform behandelt werden.)

 

Zugabe: Wie viele gentechnisch gezüchtete Pflanzen sind bisher schon auf den Feldern dieser Welt herangezogen worden?

Das ist gar nicht so einfach zu beantworten, weil ja unterschiedliche Pflanzen unterschiedlich Platz brauchen.

Zum Beispiel passen auf einen Quadratmeter (qm):

10 bis 20 Rapspflanzen, 6 bis 9 Maispflanzen und 7 bis 10 Zuckerrübenpflanzen. Sicherlich passen auch mehr drauf, nur dann wachsen sie alle ziemlich mickerig.

Ich nehme für die Abschätzung lieber zu wenig als zu viel, um ja nicht zu übertreiben. Daher nehme ich nur 6 Pflanzen je qm. Sollte es Ihnen zu wenig sein, dann nehmen Sie einfach mehr. Wir schauen in Beitrag 01 nach, wie viel Fläche im Jahr 2013 weltweit bepflanzt waren: 1.700.000 Quadratkilometer (qkm) = 170.000.000 Hektar (ha) = 1,7 Billionen Quadratmeter (qm) oder wer es lieber in wissenschaftlicher Schreibweise möchte: 1,7 x 10 hoch 12 Quadratmeter !!!

Die Quadratmeterzahl nehmen wir mit 6 mal, denn es sollen ja 6 Pflanzen auf einem Quadratmeter stehen, und erhalten: Mindestens 10 Billionen gentechnisch gezüchtete Pflanzen nur allein für das Jahr 2013.

Verteilen wir die mal auf alle 7 Milliarden Weltenbürger, dann bekommt jeder zur Zeit - Jahr für Jahr - einen schönen dicken Strauß von 1500 Pflanzen. Zu meinem Spaß - nur mal auf die ängstlichen Deutschen bezogen sind das 125.000 gentechnisch gezüchtete Pflanzen auf jeden Bewohner Deutschlands. Wie viele gefährliche erdrückende Tonnen mögen das sein? 50? 100? 150? Ich weiß es nicht. Schätzen Sie's selbst oder fragen Sie mal einen Grünling, wie viele Pflänzchen wir noch heranziehen müssen bis etwas Schreckliches passiert. Er wird Ihnen bestimmt mit moralisierendem Blick prophezeien: "Eines Tages wird Sodom und Gomora über Euch hereinbrechen, wenn Ihr nicht auf uns hört." Hören sie gar nicht hin. Aus Expertensicht sind die Chancen riesengroß, dass die Prophezeihung nicht stimmt. Die gentechnische Züchtung wird in der Summe überwältigend mehr Vorteile haben, als vielleicht vereinzelt Nachteile - genau wie bei der herkömmlichen Züchtung.

Nur damit wir uns recht verstehen. Die letzten zwei, drei Absätze sind weder ein Argument für noch gegen Pflanzen-Gentechnik. Argumente kommen jetzt. Diesmal wie angekündigt in Tabellenform. Achten Sie mal drauf, wie oft die Behauptungen, die Grünlinge über Gentechnik verbreiten, tatsächlich auch für die "normale" Züchtung zutreffen!

 

 

Tabelle 1: Behauptungen und Realität über Züchtungsmethoden bei Pflanzen

Die Behauptungen von Grünlingen über "Grüne Gentechnik" stehen in der ersten Spalte.

Die Antworten darauf finden Sie in den Spalten mit der Überschrift Methode I, II oder III. Methode I ist die gentechnische, Methode II die mit radioaktiver Strahlung oder mutagenen Giften und III die Uraltmethode.

In dieser kurzen Form, kann es nur pauschale Antworten auf die ebenso pauschalen Behauptungen geben. Jede Sorte, egal ob gentechnisch gezüchtet oder nicht, müsste differenziert betrachtet werden, je nach Pflanzenart, Vermehrungsweise und sonstige Besonderheiten einer Sorte. Am Ende der Tabelle 1 sind noch einige Ergänzungen (a, b, etc.) zu finden. Die Züchtung wird bei allen drei Methoden oft auch mit Kreuzungen und Rückkreuzungen von geeigneten Sorten kombiniert. Diese normalen Kreuzungen zwischen Sorten mit einer großen Zahl unterschiedlich veränderter Gene sind in der Tabelle noch gar nicht berücksichtigt.

 

 

Methode I

Methode II

Methode III

 

Behauptungen

von Gentechnik-Gegnern: (a)

 

Die Antworten gelten für gentechnisch [I] gezüchtete Sorten?

(angewendet ab etwa 1985)

 

Die Antworten gelten für Sorten aus herkömmlicher Mutationszüchtung? (ab etwa 1930)

 

Die Antworten gelten für Sorten aus natürlicher Auslese ohne Behandlung? (seit Jahrtausenden)

 

1. Behauptung der Grünlinge:

Es werden Artgrenzen überschritten.

 

Kann zutreffen: Ein bis wenige Gene können "artfremd" sein, aber alle übrigen 30000 Gene sind ursprünglich

 

Wie [III]. Aber zusätzlich mit stark erhöhter Wahrscheinlichkeit, dass solche Veränderungen auftreten (siehe Anmerkg. b)

 

Trifft meist nicht zu, ABER: Gene oder andere Erbgutbereiche können derart verändert sein, dass sie wie "artfremd" erscheinen. (siehe Anmerkg. b)

 

2. Behauptung der Grünlinge:

Die Technologie ist nicht präzise genug.

 

Stimmt so formuliert nicht: Der genaue Ort, wo die Gene ins Erbgut eingefügt wurden, kann mit einfachen Techniken bestimmt werden. Der Züchter sucht sich die Pflanzen aus, bei denen er mit größter Wahrscheinlichkeit keine Komplikationen erwartet.

 

Wie [III]. Außerdem: Die Zahl der Veränderungen könnte bis zu 10000fach höher sein als bei III.

 

Stimmt: Bis vor kurzem war es überhaupt nicht möglich Gene und Stellen im Erbgut zu bestimmen, an denen Veränderungen stattgefunden haben. Daher kann der Züchter auch nicht die Pflanzen aussuchen, bei denen er am wenigsten Komplikationen erwartet.

 

3. Behauptung:

Die Regulation der "natürlichen" Gene kann gestört sein.

 

Könnte passieren, ABER

auf den Markt gebracht werden nur solche Pflanzen als Sorten, die keine relevanten Störungen zeigen. (e)

 

Könnte viel eher passieren als bei I und III.

Muss nicht untersucht werden. (e)

 

Könnte sein.

 

Muss nicht untersucht werden.(e)

 

4. Behauptung der Grünlinge:

Neue Allergene könnten geschaffen werden.

 

Höchst unwahrscheinlich: Dadurch dass man weiß, welche(s) Eiweiß(e) neu gebildet wird, kann man es sehr leicht auf sein allergenes Potenzial testen, bevor die Sorte auf den Markt kommt.

 

Stimmt: Wie [III]. Jedoch könnte die Wahrscheinlichkeit für das Auftreten von Allergenen bis zu 10000fach erhöht sein.

(siehe Anmerk. c)

 

Stimmt: Jede neue Sorte könnte im Prinzip spontan auftretende Allergene enthalten. Bis vor kurzem nur zu testen durch Verzehr und Beobachten, ob es zu einer allergischen Reaktion kommt. (c)

 

5. Behauptung der Grünlinge:

Es könnten unerwartet Pflanzengifte gebildet werden.

 

Höchst unwahrscheinlich, weil die neuen Gene und Genprodukte bekannt und untersucht sind und auch der Integrationsort im Erbgut daraufhin untersucht wurde.

 

Nicht auszuschließen. Wie [III]. Jedoch könnte die Wahrscheinlichkeit für das Auftreten von Pflanzengiften bis zu 10000fach erhöht sein. (siehe Anmerk.d)

 

Nicht auszuschließen, denn jede neue Sorte könnte im Prinzip spontan auftretende Pflanzengifte enthalten. Nicht bestimmbare Genveränderungen könnten potenziell zu Veränderungen im Stoffwechsel und somit auch zu toxischen Stoffwechselprodukten führen. (siehe Anmerk. d)

 

6. Behauptung der Grünlinge:

Der Nährwert wird verschlechtert.

 

Ist wenig wahrscheinlich. Lässt sich sehr leicht testen und mit der Ausgangssorte vergleichen. Eine Sorte mit verschlechterten Nährwerten, wird erst gar nicht auf den Markt kommen; oder - wenn doch - sich auf dem Markt nicht durchsetzen.

 

Ist wesentlich wahrscheinlicher als in [I] oder [III], dass Stoffwechselvorgänge der Pflanze beeinträchtigt werden und der Nährwert schlechter ist als in der Ausgangssorte. Lässt lässt sich sehr leicht testen und mit der Ausgangssorte vergleichen

 

Ist wenig wahrscheinlich. Lässt sich sehr leicht testen und mit der Ausgangssorte vergleichen. Eine Sorte mit verschlechterten Nährwerten, wird erst gar nicht auf den Markt kommen; oder - wenn doch - sich auf dem Markt nicht durchsetzen.

 

7. Behauptung:

Transgene Pflanzen können natürliche

Populationen beeinträchti­gen.

 

Möglich, mit einem bis wenigen neuen Gen.

 

Möglich, mit vielen

veränderten Genen.

 

Möglich, mit einem bis wenigen veränderten Genen.

 

8. Behauptung der Grünlinge:

Gentechnik-Pflanzen breiten sich unkontrolliert aus.

 

Könnte vorkommen, ist aber unwahrscheinlich, da Kulturpflanzen normalerweise den Wildpflanzen unterlegen sind

 

wie (I): Könnte vorkommen, ist aber unwahrscheinlich, da Kulturpflanzen normalerweise den Wildpflanzen unterlegen sind

 

wie (I): Könnte vorkommen, ist aber unwahrscheinlich, da Kulturpflanzen normalerweise den Wildpflanzen unterlegen sind

 

9. Behauptung der Grünlinge:

Gentechnik schadet der Umwelt.

 

Nein, nicht die Züchtungsmethode per se schadet. Der Anbau in Monokulturen kann gewisse Nachteile haben, aber auch Vorteile; integrierter Landbau ist möglich

 

wie (I): Nein, nicht die Züchtungsmethode per se schadet. Der Anbau in Monokulturen kann gewisse Nachteile haben, aber auch Vorteile; integrierter Landbau ist möglich

 

wie (I): Nein, nicht die Züchtungsmethode per se schadet. Der Anbau in Monokulturen kann gewisse Nachteile haben, aber auch Vorteile; integrierter Landbau ist möglich

 

10. Behauptg. der Grünlinge:

Gentechnik hilft nicht gegen den Hunger.

 

Das könnte man auch für [II] und [III] behaupten; Probleme bei der Nahrungsmittelverteilungs haben nichts mit der Zuchtmethode zu tun.

 

Siehe [I]

 

Siehe [I]

 

11. Behauptg.:

Die Wirkung auf die menschliche Gesundheit ist ungeklärt.

 

Versuche, zur gesundheitlichen Unbedenklichkeit sind rechtlichvorgeschrieben.

 

Obwohl Gesundheitsschäden nicht auszuschließen sind, muss nichts überprüft werden

 

Obwohl Gesundheitsschäden nicht auszuschließen sind, muss nichts überprüft werden

 

12. Behauptg:

Preise für gentechnikfreie Lebensmittel steigen.

 

Jede Sorte, die einen kostengünstigeren Anbau erlaubt, benachteiligt andere Sorten.

 

Jede Sorte, die einen kostengünstigeren Anbau erlaubt, benachteiligt andere Sorten.

 

Jede Sorte, die einen kostengünstigeren Anbau erlaubt, benachteiligt andere Sorten.

 

13. Behauptg. der Grünlinge:

Patente schaffen Abhängigkeiten.

 

Diese Behauptung hat nichts mit der Zuchtmethode zu tun. Patente sind - ähnlich wie Sortenschutz - zeitlich begrenzt

 

wie (I): Diese Behauptung hat nichts mit der Zuchtmethode zu tun. Patente sind - ähnlich wie Sortenschutz - zeitlich begrenzt

 

wie (I): Diese Behauptung hat nichts mit der Zuchtmethode zu tun. Patente sind - ähnlich wie Sortenschutz - zeitlich begrenzt

 

14. Behauptg. der Grünlinge:

Fast nur noch große Konzerne beherrschen den Markt.

 

Trifft zu ABER: Es hat insofern mit der Zuchtmethode zu tun, als sich nur noch große Konzerne die horrenden Kosten der völlig überzogenene Sicherheitsuntersuchungen leisten können.

 

Trifft nicht zu: Weil praktisch keinerlei Untersuchungen zur Sicherheit durchgeführt werden müssen, können auch kleine Betriebe neues Saatgut auf den Markt bringen.

 

Trifft nicht zu: Weil praktisch keinerlei Untersuchungen zur Sicherheit durchgeführt werden müssen, können auch kleine Betriebe neues Saatgut auf den Markt bringen.

 

15. Behauptg.:

Landwirte sind gezwungen jedes Jahr neues Saatgut zu kaufen, da sie selbst keine Saatgut aus angebauten Pflanzen verwenden dürfen.

 

Das hängt von den Vertriebsbedingungen der Saatgutfirmen ab und kann auch im Rahmen des Sortenschutzes gelten.

Außerdem bleibt es jedem Landwirt unbenommen, andere frei verfügbare Sorten zu verwenden.

 

wie (I): Das hängt von den Vertriebsbedingungen der Saatgutfirmen ab und kann auch im Rahmen des Sortenschutzes gelten.

Außerdem bleibt es jedem Landwirt unbenommen, andere frei verfügbare Sorten zu verwenden.

 

wie (I): Das hängt von den Vertriebsbedingungen der Saatgutfirmen ab und kann auch im Rahmen des Sortenschutzes gelten.

Außerdem bleibt es jedem Landwirt unbenommen, andere frei verfügbare Sorten zu verwenden.

 

 

(a) Die Behauptungen und Antworten sind zum Teil einem von Prof. Kevin M. Folta ins Netz gestellten Beitrag entnommen. Seine ausführlichen Antworten darauf sind wirklich lesenswert. Kevin M. Folta ist amerikanischer Molekularbiologe und Pflanzenzüchter. Er forscht an der University von Florida. Der Beitrag ist mit der Überschrift "Atomic Gardening - The Ultimate Frankenfoods" versehen. Ein deutsche Übersetzung mit dem Titel "Atomares Gärtnern" ist bei www.novo-argumente.com/artikel/atomares_gaertnern_die_ultimativen_frankenstein_pflanzen zu finden.

Einige Behauptungen stammen vom (Des-) Informationsdienst Gentechnik und anderen "grünen" Organisationen. Diese "Info-Dienste" übersehen absichtlich "negative" Aspekte herkömmlicher Züchtung und sämtliche positiven Aspekte der Züchtung mit gentechnischen Methoden.

 

(b) zu 1. Um die Antworten in II und III zu verstehen, ist Fachwissen nötig. In Beitrag 07 und 08 wird versucht das Prinzip zu vermitteln. Letztlich sind die Antworten nur zu verstehen, wenn man mit der Art und Weise vertraut ist, wie verschiedene Mutationsarten das Erbmaterial beeinflussen können und wie genetische Information zu Eiweißmolekülen führt. Durch Deletionen, Insertionen, Translokationen, Duplikationen, Inversionen konnte und kann es zu Leserastermutationen und/oder allen nur denkbaren Kombinationen von Genen, Genteilen oder sonstigen Erbgutteilen kommen, die auch zu bisher von der Pflanze (oder deren Vorfahren) noch nie produzierten Eiweißtypen führen können; also Eiweißsorten "neuer Art". Bis vor ein paar Jahren gab es keine Methode, die schnell genug war, diese Veränderungen vor der Sortenzulassung überhaupt zu erkennen. Trotzdem hatte seit Jahrzehnten niemand Bedenken die Mutanten-Sorten zuzulassen; auch jetzt noch nicht.

Bei Gentechnik-Sorten dagegen kennt man die beabsichtigten Veränderungen sehr gut. Der Ort, an dem die zusätzlichen Erbstückchen ins Erbgut eingefügt wurden, wird nachträglich bestimmt! Sollte dieser Ort ungünstig sein, wird die Pflanze erst gar nicht als Sorte auf dem Markt gebracht. Die Zulassung erfolgt erst nach Erfüllung strengster Auflagen.

 

(c) Zu 5. Sie brauchen nur einmal unter dem Stichwort "Lebensmittelallergie" nachzusehen. Die gibt's schon immer. Nur ein Beispiel von vielen: Bei Wikipedia stand da am 27.08.2014 über die beliebte Apfelsorte Elstar: "…..allergische Reaktionen wie Kribbeln und Anschwellen der Lippen und Jucken in Mund und Rachen. Im Extremfall kann es auch zu Atemnot und Asthmaanfällen kommen....". Man weiß mittlerweile so viel über Allergie erzeugende Stoffe, dass man sogar durch Gentechnik gezielt Pflanzen züchten kann, die keine derartigen Allergie erzeugenden Stoffe mehr enthalten oder viel weniger von ihnen!

 

(d) zu 5. Gerade bei Zuchtmethoden II und III können Kreuzungen oder Mutationen zum  Auftreten von unerwünschten, unbekömmlichen Stoffen oder Giftstoffen bei den Nachkommen führen (Fachwort für Interessierte: Komplementation). Das trifft bei Kreuzungen zwischen Wildpflanzen und Kultursorten zu; ist aber auch häufig bei Kreuzungen von Kultursorten.

 

(e) zu 3. Wird in Beitrag 12 erläutert.

 

 

Tabelle 2. Sicherheitsaspekte.

Mit dem Wissen aus der Tabelle 1, können Sie überprüfen, ob die unterschiedlichen Handhabungen bezüglich "Sicherheit" für gentechnisch und herkömmlich gezüchteten Pflanzen gerechtfertigt sind.

 

 

I

II

III

Veränderg., Regelungen, Sonstiges:

 

Gentechnisch gezüchtete Sorten; seit etwa 1980

Sorten aus herkömmlicher Mutationszüchtung Züchtung; seit etwa 1930

Sorten aus natürlicher Auslese ohne Behandlung; seit Jahrtausenden

 

Anzahl der betroffenene Gene?

 

ein bis wenige; Anzahl bekannt

 

deutlich mehr als bei [III]; genaue Anzahl bisher meist nichtbekannt

 

vermutlich wenige; genaue Anzahl bisher meist nicht bekannt

 

Behördlich regulierter Prozess?

 

ja

 

nein

 

nein

 

Im Tierversuch auf

Sicherheit getestet?

 

ja

 

nein

 

nein

 

Untersuchung der Umwelt-Verträglichkeit

 

ja

 

nein

 

nein

 

"Biosiegel"- zugelassen?

 

nein

 

ja

 

ja

 

In der EU zugelassen?

 

vereinzelt

 

ja

 

ja

 

Kennzeichng.?

 

Kennzeichnung vorgesehen

 

Niemanden interessiert es

 

Niemanden interessiert es

 

Können Züchtungen

patentiert werden?

 

In Europa: Methoden: Ja.

Sorten: Wohl nicht?

USA: Ja, Beides

 

In Europa: Methoden: Ja.

Sorten: Wohl nicht?

USA: Ja, Beides

 

In Europa: Methoden: Ja.

Sorten: Wohl nicht?

USA: Ja, Beides

 

Sind Aktivisten gegen Sorten?

 

ja

 

anfangs nein; jetzt vielleicht "jein"

 

nein

 

Verwüsten Aktivisten Felder auf denen Pflanzen angebaut werden?

 

ja

 

nein

 

nein

 

 

Immer noch nicht so richtig überzeugt, weil die Vorurteile sich tief in Ihre Gefühlszentren im Gehirn eingegraben haben. Besser gesagt seit 30 Jahren von Grünlingen und ihren grünen Reportern unaufhörlich eingegraben wurden; am Anfang vielleicht wirklich mit der Überzeugung etwas Gutes tun zu wollen; aber mittlerweile mit der Trotzhaltung eines Kleinkinds. Oder stecken sogar schon wirtschaftliche Interessen dahinter, wenn man die Gefühle von Mitmenschen manipuliert? Ja, Grünlinge verstehen es trefflich mit dem Wort "Manipulation", mit Tricks, die gentechnischen Pflanzen immer in einem schlechten Licht erscheinen zu lassen. Schauen Sie sich einmal genau die Webseiten an. Die Wortwahl, die Zeichnungen, Bilder und Assoziationen. Da wird manipuliert was das Zeug hält. Und perfiderweise bezeichnet man gentechnisch gezüchtete Pflanzen als "manipulierte Genpflanzen". Eigentlich stammt der Ausdruck "manipuliert" in diesem Zusammenhang aus der englischen Fachliteratur. Im Englischen bedeutet es eher "mit den Händen verändern", auch zum Positiven. Im Deutschen dagegen wird Manipulation assoziiert mit: Beeinflussung, Überredung, Verhetzung; Suggestion; Agitation, Demagogie, Indoktrination; Kniff, List, Schliche, Trick, Winkelzug, Dreh, Masche, Machenschaften.

"Manipulieren" ist das ideale Wort, um eine gute Sache zu verunglimpfen, denn man nimmt ja nur einen in der Fachliteratur verwendeten Ausdruck. Wie perfide das ist, hat Prof. R. Szibor in einen sehr guten Beitrag beschrieben:

Grüne Gentechnik: Sprache und Antigentechnik-Demagogie,

//www.novo-argumente.com/artikel/sprache_und_anti_gentechnik_demagogie

.

Dabei wollen Züchter den Landwirten und den Konsumenten die besten Sorten zur Verfügung stellen. Effizient und passgenau, wie in Beitrag 04 beschrieben. Klar wollen sie auch dabei verdienen, denn wer arbeitet schon gerne jahrelang umsonst?

Es würde keinem Autohersteller gefallen, wenn man seine überarbeiteten oder verbesserten Modelle als "manipulierte" Versionen bezeichnete (von der Diskussion um die Dieselabgase mal abgesehen). Nur Züchter und Landwirte müssen sich das gefallen lassen.

Wenn man denn unbedingt das Wort "manipuliert" gebrauchen möchte, dann wäre es noch am ehesten bei Sorten aus der Mutationszüchtung gerechtfertigt, da weiß man tatsächlich nicht, was alles verändert ist (Beitrag 07).

Schon bei ganz normaler Züchtung gibt es "Risiko und Ungewissheit". Informieren Sie sich doch einfach mal über die Kartoffelsorte "Lenape" [1]. Das ist ein Beispiel für "ganz normale Züchtung". Alle möglichen "ganz natürlichen" Kultursorten können uns auch "ganz natürlich" z.B. allergische Reaktionen bescheren [2], wenn wir ganz natürliche Sorten kreuzen.

 

Zum Nachschauen oder zur Ergänzung: [1] www.gute-gene-schlechte-gene.de/gift-gene-zuchtung-lenape-kartoffel/ [2] z.B. Stichwort "Elstar" auf Wikipedia vom 27.08.2014; da stand: Nach einer Studie des Deutschen Allergie- und Asthmabunds reagieren viele Apfelallergiker oft auf jüngere Apfelzüchtungen (Anmerkung: OHNE Gentechnik) wie Elstar, Jonagold oder Golden Delicious mit allergischen Reaktionen wie Kribbeln und Anschwellen der Lippen und Jucken in Mund und Rachen. Im Extremfall kann es auch zu Atemnot und Asthmaanfällen kommen.

 

Nicht vergessen:

► Bei den meisten althergebrachten Sorten weiß man bis heute nicht, was genau so alles verändert ist. Beitrag 06.

► Bei Mutantenzüchtung (aber auch bei Kreuzungszüchtung) entsteht eine unübersehbare Vielzahl an Nachkommen; nicht so bei der gentechnischen Züchtung. Mutantenzüchtung erweitert aber erfolgreich die "natürliche" Auslese-Züchtung. Beitrag 07.

► Zufällige Verdrehungen und Einfügungen bei Mutationszüchtung, aber auch ganz "normale" Züchtung können den Sinn im Erbgut verändern. Beitrag 08.

 

 

 

10.

...von Schmarren, Romantik und Feuer...

Wenn meine Frau Schmarren macht, ist er leicht und bekömmlich. Den esse ich mit Vorliebe. Aber diesen Schmarren meine ich jetzt nicht.

Manchmal habe ich so richtig Wut auf diese Grünlinge. So eine Tag ist heute. Warum gerade heute? Weil ich mal was auf den Webseiten dieser Ökogläubigen nachsehen wollte und wieder unsäglichen Sch...marren zu lesen bekam. Der klingt für Laien seriös, hört sich wissenschaftlich an, ist aber Sch...marren.

Ich bin keine Freund von Schimpfwörtern, aber hier allein im Kämmerlein zu Hause darf ich fluchen. Meine Frau bekommt es manchmal mit und räuspert sich dann. Nicht weil sie meine Meinung nicht teilt, sondern weil sich fluchen nicht gehört.

Ein paar vernünftige Ansichten kann man auf den Webseiten schon finden; leider nur ein paar. Hier der Sch...marren über den ich pauschal einmal Dampf ablassen muss:

 

Einige große Schlagworte haben die Grünlinge ins Gedächtnis ihrer Zeitgenossen gehämmert. Zum Beispiel:

Natur - wie gut sie zu uns ist und wie böse doch der moderne Mensch mit ihr umgeht.

Kernkraft - wie unbeherrschbar und gefährlich sie doch ist.

Gentechnik - wie widernatürlich und unberechenbar sie doch sein kann.

Mit diesen Schlagworten haben sie Terrain erobert - leider viel zu viel.

Und nun habe ich Lust richtig zu übertreiben und zu pauschalisieren. So ähnlich wie es Grünlinge andauernd tun.

 

Natur.

Grünlinge definieren Natur, so wie es ihnen in den Kram passt. Was nicht fehlen darf, sind Bilder von blühenden Wiesen, von unberührten Wäldern und Flussauen, von Gebirgs- und Seenlandschaften. Landschaften mit unübertroffener Artenvielfalt in trauter Harmonie besiedelt von unzähligen Tierarten und seltenen Pflanzen. Wo der Landwirt und die Bäuerin, die Mägde und Knechte mit einem fröhlichen Lied auf den Lippen und der Flugschar auf dem Acker ein Stückchen dieses Paradieses bewirtschaften dürfen und wo glückliches Vieh freudig über die Weiden springt, am munter plätschernden Bächlein trinkt und zufrieden aus der Stalltür hervorschaut. So sprechen sie die romantischen Gefühle ihrer Mitmenschen an.

Aber so ist "Natur pur" nicht. Jedes nicht gepflegte Grundstück wird bei uns über kurz oder lang von Bäumen erobert. "Natur pur" heißt, fast nur noch Wald in Europa und mückenverseuchte Sümpfe, so wie vor Jahrtausenden. Da bleibt für "Ökoanbau" der Platz zwischen den Bäumen übrig. Auf diese Weise allein in Deutschland 80 Millionen Menschen ernähren zu wollen, ist Schwachsinn pur und menschenverachtend. Das wissen auch die Grünlinge.

Trotzdem verzieren sie Natur hübsch mit grüner Romantik, sie soll Herz und Seele erfreuen und Sehnsucht nach dem Paradies erwecken. So gewinnt man Kämpfer für die gerechte Sache. Aber Natur ist nicht romantisch: Erdbeben, Vulkanausbrüche, Tsunamis, Wetterkapriolen, Hitze- und Kältewellen, Überschwemmungen, durch unzählige Schädlinge dezimierte Ernten, Hungerkatastrophen, Krankheiten und Seuchen aller Art. "Wer eins mit der Natur sein will, fängt am besten während einer Naturkatastrophe an" schrieb treffend der Mathematiker und Philosoph Bertram Russel. "Googlen" Sie unter den obigen Stichworten und sie werden erkennen, dass dem Menschen eigentlich nichts anderes übrig bleibt, als gegen die "pure Natur" zu "kämpfen". Viele wollen das in unserer "gepamperten" westlichen Welt nicht mehr wahr haben. Ich gestehe ja zu, dass der Mensch das Kämpfen manchmal übertreibt.

 

Technik.

Zum unserem großen Glück können wir uns seit etwa zwei, drei Jahrhunderten zunehmend und immer schneller - wie nie zuvor in der Menschheitsgeschichte - naturwissenschaftlicher Methoden bedienen, um der Natur etwas von ihrer Bedrohung zu nehmen. Dass sich Menschen vor Techniken fürchten, mag auch mit der so leicht dahergeplapperten Devise "mit der Natur leben" zu tun haben. Man zieht eine künstliche Trennlinie, und tut so, als ob wir Menschen mitsamt unserer Technik nicht selbst ein Produkt der Evolution und damit der Natur wären. Wenn die Natur uns Sensoren zum Erkennen und einen Kopf zum Denken gegeben hat, dann sollte wir das nutzen. Dann muss das ungläubige Bauchgefühl eben auch Fakten und Tatsachen akzeptieren.

Grünlinge sagen, wenn schon Technik, dann beherrschbare. Nur welche? Feuer? Feuer, zum Beispiel, auf das wir als Menschen so stolz sind, ist keine beherrschbare Technik. Trotzdem hat Feuer uns erst zu Menschen gemacht. Durch Grillen, Braten und Kochen erweitern wir unser Nahrungsspektrum, verwerten wir unsere Nahrung besser, holen mehr aus ihr heraus. (Warum sollten wir es heute nicht zusätzlich auch mittels Gentechnik tun?) Unsere Vorfahren mussten daher weniger jagen und sammeln und hatten somit mehr Zeit zum Denken und um Nachkommen in die Welt zu setzen.

Versetzen wir uns mal in diese Vorzeit zurück und stellen uns den Ur-Grünling vor, mit seinem Spruch: Nix Feuer, sonst Hütte weg, große Brandblasen, Tod.

Oder zeitgemäßer: Feuer gar nix gut, macht Dioxin, Acrylamid, Benzpyren, Krebs. Vielleicht konnten die grünen Ur-Aktivisten zu jener Zeit noch nicht reden, sondern fuchtelten wild mit den Armen und droschen mit Knüppeln auf das Feuer ein. Wie gut für die Stämme, die die Warnungen in den Wind geschlagen haben; wie gut für uns als Nachfahren. Wie gut für uns, dass unsere Vorfahren auch viele andere Warnungen vor bösen Techniken in den Wind geschlagen haben. Denn sonst hätten wir heute "Natur pur" und eine heile idyllische Welt mit Raubtieren, Krankheitskeimen und Parasiten, die sich fröhlich über unseren Körper her machen, um uns auf natürliche Weise zu zerreißen, zu zerfressen oder elendig dahinsiechen zu lassen. Wie wunderbar ist doch "Natur pur". Klar kann uns auch Technik ziemlich übel mitspielen, aber immerhin haben wir es mit Technik geschafft, den Planeten äußerst erfolgreich zu bevölkern.

Wären die Grünlinge konsequent, müssten alle Techniken, die von Menschen nicht beherrschbar sind, abgeschafft werden, wie der Umgang mit jeder Art von Feuer - auch in seiner modernen Form als explodierende Zentralheizung und funkensprühende Steckdosen. Suchen sie mal im Internet unter dem Stichwort "verheerende Brände".

Beispiele dafür, dass viele Techniken nicht beherrschbar sind, gibt es weltweit genug. Wie wäre es mit "Opfer im Straßenverkehr". Sie werden erstaunt sein, allein die jährlichen Toten übersteigen weltweit eine Million. Zählen wir dazu noch etwa sechs Millionen Schwerverletzte (jährlich!) mit Quetschungen innerer Organe, Augenverletzungen, Schädeltraumata, Schädelbrüchen, Querschnittslähmungen und anderem mehr. Viele der Betroffenen und Angehörigen leiden Jahrzehnte schwer darunter. Dagegen fast schon winzig nimmt sich die Zahl der Opfer innerhalb der gesamten 60 Jahre aus, in denen es Energie aus Kernkraftwerken gibt.

 

Kernkraft.

Nehmen Sie zum Vergleich doch einmal das Stichwort "Tote durch Kernkraft". Lassen Sie sich aber nicht täuschen. Die laut Greenpeace Propaganda 90.000 und mehr sind "irgendwie statistisch hochgerechnete" Zahlen. Dazu zählen dann auch solche, die vielleicht statistisch statt 99,9 Jahre nur 99,8 Jahre leben sollen. Das einzige wirklich schlimme Unglück geschah in Tschernobyl. Laut UNO Angaben soll die Zahl derjenigen, die dort an einer tödlichen Dosis Radioaktivität verstorben sind, bei etwa 150 liegen. Selbst wenn man einmal die Greenpeace Zahlen akzeptierte, betrügen die nur ein Tausendstel dessen, was 60 Jahre Straßenverkehr angerichtet haben. Hier müssen einfach mal die Verhältnisse ins rechte Licht gerückt werden, auch von grünen Irrlichtern.

Grüne kümmern sich nicht um Ökonomie, wenn sie ihre verqueren Fantasien der Gesellschaft aufzwingen können. Kraftwerke, die Strom im Überfluss liefern, Gewinne abwerfen und dadurch der Gesellschaft noch Jahrzehnte Steuern in die Kassen spülen, werden ohne Sinn und Verstand abgeschaltet. Sogar Entschädigung muss der Staat wegen Vertragsbruch u.U. leisten. Wegen der stark verkürzten Laufzeiten lamentieren die Grünlinge nun scheinheilig, dass jetzt die Rückstellungen der Energiekonzerne nicht ausreichen. Statt aus dem Kernkraftwerksunfall in Fukushima zu lernen, noch bessere Vorkehrungen zu treffen, so wie die Japaner jetzt, wirft man in Deutschland einfach Volksvermögen zum Fenster hinaus. Dieses Geld hätte man besser für eine kostengünstige Umstellung auf "ökologische" Stromerzeugung verwenden sollen, wenn letztere denn auf Dauer tatsächlich besser sein sollte.

Energie im Überfluss ist das Einzige, was uns unseren hohen erreichten Lebensstandard sichern und weiter verbessern kann. Billige Energie macht unbegrenztes Recyceln möglich. Mit Energie im Überfluss wird es keine Rohstoffknappheit geben, keinen Treibstoffmangel. Billige Energie ist nötig, um auch denjenigen rasch ein menschenwürdiges Leben zu ermöglichen, die zur Zeit in vielen Teilen der Welt noch Not leiden.

Grünlinge faseln von radioaktivem Millionen Jahre strahlendem Müll und wollen in ihrer naturwissenschaftlichen Ignoranz keine Weiterentwicklung der Kernphysik akzeptieren. Aber Physiker und Techniker an der Forscherfront sind dabei Methoden zu entwickeln, die uns aus den Rückständen, "dem Müll", der Kernspaltung noch weit mehr als 20 mal so viel Energie gewinnen lässt, als daraus bisher überhaupt gewonnen wurde. Die nötigen Lagerzeiten der dann noch anfallenden geringen Mengen an radioaktiven Reststoffen verkürzen sich auf beherrschbare 300 Jahre; um sie schließlich als nicht radioaktive Wertstoffe nutzen zu können. Dazu kommen noch passive Sicherheitssysteme, die auch beim Ausfall jeglicher Kontrolle die Kernreaktionen beenden würden.

Und schließlich: Jetzt ein paar Kilo mehr an Rückständen zu den schon vorhandenen Tonnen hätte Deutschland und die Welt auch nicht unsicherer gemacht.

 

 

Chemikalien.

Grünlinge sind gegen "Chemikalien". Zumindest machen sie einen Riesenwirbel, wenn nur ein paar Moleküle zu viel über den festgesetzten Grenzwerten gefunden werden. Auch das ist Angstmache. Bei den Grenzwerten werden in den allermeisten Ländern hohe Sicherheitsspannen berücksichtigt. Weil dem so ist, können sich die Grenzwerte von Land zu Land um ein Mehrfaches unterscheiden. Denn wie heißt es so schön in einem kölnischen Karnevalslied: Drei mal Null ist Null, bleibt Null. Oder leicht abgewandelt: Drei mal fast Null ist nahezu Null, bleibt nahezu Null. Ab Juli 2015 rauscht die von Grünlingen hirnlos (oder vielleicht absichtlich) aufgeblasene Mitteilung "Glyphosat in Muttermilch" durch sämtliche Medien. Die genaue Überschlagsrechnung [1], die vor lauter Medien-Müll zum Thema kaum zu entdecken ist, ergab: Ein Säugling hätte täglich um die 2.700 Liter oder - anderes ausgedrückt - fast 3 Tonnen Muttermilch trinken müssen, um den in Deutschland vorgegebenen täglichen (!) Grenzwert zu überschreiten. Er hätte dann noch 100 bis 1000 mal mehr Milch trinken müssen, um so viel Glyphosat zu sich genommen zu haben, dass es zu ersten erkennbaren Schäden gekommen wäre. Die Sache ist so abstrus, dass ich mir nicht verkneifen konnte, noch ein wenig zu rechnen. Nehmen wir nur mal an, ein Säugling trinkt täglich einen halben Liter Milch, dann wäre er mit 300 Tonnen erst in rund 1500 Jahren fertig.

Nur so nebenbei erwähnt: Manchmal sind die Sicherheitsvorschriften in den USA sogar strenger als bei uns. Mitbürger lassen sich leicht durch das Geschrei, welches Grünlinge bei chemisch klingende Bezeichnungen von Stoffen anstimmen, verunsichern. Klicken Sie doch mal auf die satirischen Webseiten über die Substanz "Dihydrogenmonoxid". Oder nehmen Sie das "Chlorhühnchen" aus den USA. Ein Riesenaufschrei. Aber geben Sie mal "Chloren von Trinkwasser" bei einer Internetsuchmaschine ein: In England und Frankreich ist das "Chloren" wohl immer noch Standard; bei uns war es bis Anfang der 90er Jahre gängige Praxis und ist unter bestimmten Umständen heute immer noch ein paar Wochen lang erlaubt.

Sie selbst mögen genau wie die Grünlinge auch keine "Chemikalien"? Dann bitten Sie den Anästhesisten bei einer anstehenden Operation - die ich Ihnen natürlich nicht wünsche - inständig um ein "natürliches" Narkosemittel. Wie schrecklich solche Operationen bis in die Anfänge des 20. Jahrhunderts waren, habe ich, wenn ich mich recht erinnere, anschaulich in Bill Brysons Buch "Eine kurze Geschichte der alltäglichen Dinge" gelesen [2].

Sie möchten wirklich keine "unnatürlich technische" Chemie mehr? Dann viel Spaß bei ihrer Zeitreise in die dunkle Vergangenheit ohne Kommunikationsmittel, ohne effiziente Transportmittel, ohne Elektrizität; mit Läusen in den Haaren oder Würmern im Darm, zurück in eine Welt mit schnell vergammelnden Lebensmittel, mit mickerigen Ernteerträgen, die nur gerade mal ein paar hundert Millionen Menschen ernähren können - aber keine sieben oder mehr Milliarden.

 

Konzerne.

Grünlinge wollen am liebsten die Konzerne abschaffen. Autos, Elektronikgeräte, Haushaltsgeräte, Kleidung und vieles mehr in Kleinstbetrieben? Wie soll das alles produziert werden, damit es für alle reicht und auch bezahlbar bleibt? Fließbandarbeit, so schlimm sie für diejenige in den Anfängen war, die am Band arbeiten mussten, Fließbandproduktion beschert uns all die angenehmen Dinge, die keiner - außer den Grünlingen - mehr missen möchte. Fragen Sie mal einen Grünling, ob er sich seine ganze Kleidung inklusive Unterhosen und -hemden beim Schneider anfertigen lässt oder ob er seinen Propaganda-Computer in Handarbeit hat fertigen lassen. Ohne die Produktion und den Vertrieb in und durch Konzerne wird sich kaum einer die alltäglichen Dinge leisten können, die für uns alle zur Selbstverständlichkeit geworden sind.

Kohle-, Öl- und andere Förderungen vielleicht im Kleinstmaßstab, so wie man es noch an einigen Stellen der Welt antrifft? Oder Förderung unter staatlicher Kontrolle à la DDR-Sozialismus mit staatlich sanktionierter Umweltverschmutzung. Da habe ich doch tausendmal lieber Großkonzerne in einer freien Wirtschaft, vor deren Türen man grölend demonstrieren kann. Zur Not kann man aber auch an deren Werkstor pinkeln oder sie verklagen.

Oder Nahrungsmittel in Kleinstbetrieben produzieren? Agro-Konzerne sind den Grünlingen ein besonderer Dorn im Auge. Nahrungsmittelproduktion in Kleinstbetrieben hatten wir schon mal im vorletzten Jahrhundert und die ganzen Jahrhunderte zuvor. Das haben wir auch heute noch in den ärmsten Regionen der Welt. Warum machen uns das die Grünlinge nicht einmal vor und verwenden ihre Spendengelder für die von ihnen propagierten Anbaumethoden, statt sie für Ketten-, Klammer- und Blockieraktionen zu verwenden? Die Antwort lautet: Weil es damals nicht funktioniert hat und weil es jetzt bei der riesigen Zahl an Menschen schon gar nicht funktionieren wird. Grünlinge erzählen uns Märchen und unkritische Mitmenschen hören ihnen gläubig und begeistert zu.

 

Gentechnik.

Grünlinge mit ihrem hysterischen Geschrei beim Wort "Gentechnik" besonders im Zusammenhang mit Pflanzen, kann man nur als schizophren bezeichnen. Sie übersehen dabei geflissentlich, dass auch "normale" Züchtung mit völlig "widernatürlichen" Methoden arbeitet. Zumindest müsste man das aus "grüner Sicht" so bezeichnen. Oder halten Sie die gleichzeitige radioaktive Bestrahlung von zehntausenden von Pflanzensamen oder das Baden der Samen in hochkonzentrierten chemischen Mutagenen im Labor für natürlich (?) oder gar das Fusionieren von Zellen verschiedener Arten und das künstliche Hochpeppeln solcher Chimären? Spricht man sie darauf an, versuchen sie sich trotzdem mit der Behauptung herauszuwinden, das könne in der der Natur so ähnlich auch vorkommen. Da muss man doch fragen, wo? Sollen sie uns doch mal die Stellen zeigen, wo das ganz natürlich so passiert. Aber dieses Thema hatten wir schon mal in den Beiträgen 04, 07, 08 und 09.

 

Vom Wert naturwissenschaftlicher Argumentationen verstehen Grünlinge nicht die Bohne. Wenn man in zig wissenschaftlichen Arbeiten und Artikel, die mit Akribie von anerkannten Wissenschaftlern durchgeführt wurden, zum Ergebnis kommt, gentechnisch gezüchtete Pflanzen sind genauso ungefährlich (oder gefährlich?) wie "normal" gezüchtete, dann werden die Ohrstöpsel eingeschoben und die Scheuklappen angelegt. Dann werden alle Wissenschaftler als Lobbyisten verunglimpft. Dann folgt die grüne Angstmasche. Krampfhaft wird eine Untersuchung in Auftrag gegeben oder hervorgekramt, egal wie schlampig durchgeführt, mit der man verunsichern kann. Laien können weder die Güte der zitierten Arbeit einschätzen noch deren Scheinargumente durchschauen. Allen, die darauf reinfallen, bieten sich Grünlinge hinterhältig als gemeinnützige Weltenretter an. Das ist schon eine perfide Methode und nichts als eine grobe Irreführung. In dieser Hinsicht sind Grünlinge tatsächlich wahre Experten. Sie sind Meister im Erfinden hypothetischer riesiger Gefahren für die Zukunft. Aber nichts ist ungewisser als die Zukunft. Die Warnungen vor jeder unnatürlichen, nicht beherrschbaren Technik tragen neurotische Züge, denn zu keiner Zeit haben mehr Menschen besser, gesünder, länger gelebt als heute in vielen Ländern der Welt - nicht nur in den westlichen. Aber das bestimmt nicht Dank "grünem" Aktionismus, sondern Dank der fleißigen, unermütlichen Arbeit von Technikern und Tüftlern; Dank Weiterentwicklung und Verbesserungen in Naturwissenschaft und Technik.

So, jetzt ist mir besser. Manchmal muss man einfach pauschalisieren. Da habe ich mir wohl ein schlechtes Beispiel an den Grünlingen genommen. Es soll nicht wieder vorkommen. Oder? Mal sehen...

Nehmen wir es leicht und locker. So wie den richtigen Schmarren, den mir meine Frau zu meiner Freude zubereitet hat.

 

Passend zum Thema noch eine kleine Zeichnung:

 

 Abb.1. Blick in eine NATÜRLICHE Welt











 

 

Bei der kritischen Begutachtung machten mich "kompetente" Grünlings-Experten auf zwei Fehler in der Abbildung aufmerksam, die NATÜRLICH völlig unnatürlich sind und die ich in Abbildung 2 korrigiert habe.









 

Abb.2. Blick in eine NATÜRLICHE Welt (korrigiert)



Es gibt NATÜRLICH keine (Säuge-)Tiere, die Pfeilspitzen verwenden. Und bisher wurde auch noch nie beobachtet, dass (Säuge-)Tiere gemütlich am offenen Feuer sitzen. Oder?

 

Zum Nachschauen oder zur Ergänzung:

[1] schillipaeppa.net/ oder www.novo-argumente.com/magazin.php/novo_notizen/artikel/0001920 [2] Sie können aber auch bei Wikipedia nachsehen.

 

Nicht vergessen:

► Bei den meisten althergebrachten Sorten weiß man bis heute nicht, was genau so alles verändert ist. Beitrag 06.

► Bei Mutantenzüchtung (aber auch bei Kreuzungszüchtung) entsteht eine unübersehbare Vielzahl an Nachkommen; nicht so bei der gentechnischen Züchtung. Mutantenzüchtung erweitert aber erfolgreich die "natürliche" Auslese-Züchtung. Beitrag 07.

► Zufällige Verdrehungen und Einfügungen bei Mutationszüchtung, aber auch ganz "normale" Züchtung können den Sinn im Erbgut verändern. Beitrag 08.

► Im Jahr 2013 wuchsen weltweit schon mindestens 10 Billionen gentechnisch veränderter Pflanzen auf den Feldern. Beitrag 09.

► Ein Tabellarischer "Gefahren"-Vergleich von Züchtung mit und ohne Gentechnik. Beitrag 09.

 

 

 

 

11.

...zur Abwechslung mal ein Flugblatt...

!!! Dies ist keine Reklame !!!

 

Sie sollen an keiner Butterfahrt teilnehmen, nichts kaufen und auch nichts spenden (!), sondern nur mal einen Moment nachdenken. Zu gewinnen gibt's vielleicht eine Erleuchtung.

 

(Kreuzen Sie bitte an)

Zu wem gehen Sie oder bei wem holen Sie sich Information wenn

 

 

Sie krank sind?

 

 

[ ]

Arzt

[ ]

Grünlingen

 

Ihre Waschmaschine nicht funktioniert?

 

[ ]

Elektrokundendienst

[ ]

Grünlingen

an Ihrem Auto was defekt ist?

[ ]

Automechaniker / Werkstatt

 

[ ]

Grünlingen

Ihr Telefon oder Handy streikt?

[ ]

Telefonladen / Telefongesellschaft

 

[ ]

Grünlingen

der Strom in ihrem Haus ausfällt?

[ ]

Elektriker / Stromver­sorger

 

[ ]

Grünlingen

Sie Ihre Topfpflanzen richtig versorgen wollen?

[ ]

Gärtner / Gärtnerei

 

 

[ ]

Grünlingen

Sie wissen wollen, wie moderne Landwirtschaft hochwertige Nahrungsmittel für Milliarden Menschen bereitstellen kann?

[ ]

ausgebildeten Agrar­wissenschaftler / aner­kannten Biologen / kom­petenten Pflanzenzüchter

[ ]

Grünlingen

 

Sollen wir wetten?

Bei den ersten sechs Fragen haben Sie die Antworten in der zweiten Spalte angekreuzt!

Weshalb dann bei der letzten Frage die Antwort in der dritten Spalte?

 

Grünlinge aus sogenannten Umweltorganisationen suchen sich gerne "Experten", die aus meiner Sicht dem Esoterikbereich zuneigen und deren "Weisheiten" oft der Kaffesatzdeuterei entspringen, als dass sie auf seriösen Untersuchungen fußen. Unablässig verbreiteten unkritische Medien längst widerlegte alte oder um- und neuformulierte Behauptungen von Grünlingen. Hauptsache, die Meldungen enthalten Worte wie Manipulation, Risiko, Gefahr, Skepsis und Ablehnung.

Informieren Sie sich über gentechnisch modifizierte Kulturpflanzen lieber bei Fachleuten von anerkannten Gesellschaften, Forschungseinrichtungen und Instituten. Einige Webseiten dazu finden Sie in Beitrag 01.

 

 

 

 

12.

...zwei Text-Zitate und eine provisorische Antwort...

 

Wer weiß schon bis ins letzte Detail genau, wie ein Gen (Erbanlage) funktioniert?! Jedes Lebewesen hat je nach Art, tausende bis zehntausende verschiedene Erbanlagen (Beitrag 03). Jedes Gen funktioniert ein bisschen oder oft auch ziemlich anders als die anderen. Die meisten sind für die Bildung von Eiweißen zuständig, jedes Gen für eine andere Eiweißsorte [4]. Selbst bei Genen, die seit 50 Jahren untersucht werden, findet man immer noch Neues.

Trotzdem möchte ich einfach mal wagen, Ihnen zwei Zitate vorzustellen. Lieben Sie Text-Interpretationen? Eher nicht? Dann überspringen Sie einfach diesen Beitrag und lesen zuerst Beitrag 13. Wenn Sie damit durch sind, dann versuchen Sie's halt nochmal mit dem vorliegenden. Wenn Sie sich jetzt schon durchbeißen wollen, kann ich Ihnen zu Erleichterung verraten: Es sind keine Zitate von Theologen oder Philosophen und auch nicht von Germanisten oder Juristen.

Die Zitate sind relativ kurz. Das erste stammt von Grünlingen mit Pflanzen-Gentechnik-Phobie (aus dem Jahr 2012) [1]. Das zweite stammt aus einem Lehrbuch von 1970. Es wurde von zwei bekannten deutschen Genetikern geschrieben [2].

 

Hier das Zitat der Kritiker:

Wie verschiedene Untersuchungen zeigen, kann durch die Methode des Gentransfers ungewolltauch die Aktivität anderer Gene und der Stoffwechsel der Pflanzen verändert werden. Die Genaktivität in den Zellen der Pflanzen wird normalerweise durch das fein abgestimmte System der natürlichen Genregulation kontrolliert.Mit den invasiven Verfahren der Gentechnik wird die Aktivität der zusätzlich eingefügten Gene aber mit technischen Hilfsmitteln erzwungen und die natürliche Genregulation umgangen.....

 

Verstanden was gemeint ist? Nun, "invasiv", das klingt zumindest beeindruckend beängstigend! Und es wird auch was mit "technischen Hilfsmittel erzwungen". Erinnern Sie sich noch an Beitrag 07 und 08. Da klang es doch auch bei der Mutanten-Methode ziemlich beängstigend invasiv und technische rabiate Hilfsmittel mit denen was erzwungen wurde, gab's da auch; sogar bedeutend rabiater als bei der Gentechnik-Methode. Und schließlich wird auch noch die "natürliche Genregulation umgangen". Wie schlimm.

Wenn Sie nicht nachvollziehen können, was die Autoren meinen, ist es auch egal; es ist Grünlings-"Experten"-Meinung. Es macht aber auch nichts, wenn Sie beim folgenden Zitat nicht alles verstehen. Achten Sie einfach beim Zitat der anerkannten Genetiker besonders auf das von mir "fett" markierte und vergleichen Sie es mit dem ersten Zitat. In Klammern ( ) stehen entweder kurze Erklärungen meinerseits oder ich habe Seitenverweise weggelassen, die das Buch betreffen. Also hier das Zitat:

Im Grunde genommen bestehen durch die Vernetzung aller Stoffwechselwege und durch Konkurrenz um Substrate, Ribosomen, Transfer-RNA usw. Wechselwirkungen zwischen allen Genen. Dies gilt besonders für architektonische Merkmale, die vermutlich von der Quantität gewisser Substanzen zu bestimmten Zeiten der Embryonalentwicklung durch entsprechende Steuermechanismen festgelegt werden. Wie wohlausgewogen der gesamte Ablauf der Genwirkungen ist, geht aus der Beobachtung hervor (...), daß auch kleinere Deletionen schon heterozygot oft letal (tödlich) sind. Obwohl also die erforderliche Information in einem Exemplar vorhanden ist, (es ) genügt die Störung, um den ganzen Ablauf der Genwirkungen aus der Bahn zu werfen. Dieses überraschende Ergebnis erklärt sich möglicherweise durch eine Störung der Regulation."

Finden Sie nicht, zumindest die von mir "fett" gekennzeichneten Stellen weisen eine ganz erstaunliche Ähnlichkeit mit dem ersten Zitat auf? Klar die Formulierungen sind ein wenig anders; es liegen ja auch über 40 Jahre Forschung dazwischen. Und klar, der Text klingt komplizierter; er ist ja auch für Studenten geschrieben. Und klar, taucht im zweiten Text das Wort "Gentechnik" noch nicht auf, denn die war ja noch nicht erfunden. Statt dessen finden wir aber das Wort "Deletionen". Das ist uns schon mal in Beitrag 08 und 09 kurz begegnet. Deletion ist eine Art von Mutation, wo ein Stückchen Erbsubstanz verloren geht, wie es normal (!) und natürlich (!) in allen Lebewesen vorkommen kann; besonders gern bei rabiater radioaktiver Bestrahlung.

Den Effekt dieser Mutation beschreiben die Genetiker praktisch genau so, wie es die überkritischen Grünlinge nur für die Gentechnik gelten lassen wollen. Obwohl seit 40 Jahren bekannt, verschweigen uns also die Kritiker, dass "natürliche" Mutationen, die gleichen Effekte haben können, wie sie - in ganz seltenen Fällen - auch bei gentechnisch veränderten Pflanzen auftreten können. Wobei sie dann hinterhältigerweise auch noch verschweigen, dass gentechnisch gezüchtete Pflanzen erst gar nicht als Sorte auf den Markt gebracht werden, wenn denn tatsächlich zum Ende des Züchtungsverfahrens gravierende Störungen auftreten sollten. Daher zum x-ten Mal: Gentechnisch modifizierte Sorten werden mit den neuesten uns zur Verfügung stehenden Techniken auch auf so was wie "Regulierung und Deregulierung" getestet. Man untersucht dazu - um es einmal in der Fachsprache auszudrücken - das Transkriptom, das Proteom, das Metabolom [5] und noch andere Parameter. Die Züchter setzen natürlich alles daran, nur solche Pflanzenlinien in Verkehr zu bringen, die sich von der Ausgangssorte eben nur in den Merkmalen unterscheiden, in denen sie sich unterscheiden sollen.

Und schließlich nochmal zum Einprägen: Bei "natürlich" gezüchteten Sorten weiß man in den meisten Fällen gar nicht, was alles zusätzlich verändert ist.

Nicht nur die Deletionen, alle "natürlichen" Mutationsarten können die Genregulation aus der Bahn werfen. Das sehen richtige Experten heute immer noch so. Aber deren Meinung wird vom Propaganda-Müll der grünen Aktivisten zugeschüttet.

Um es noch weiter zurecht zu rücken: Seit Anbeginn unserer Entwicklung zur Spezies Mensch sind wir immer einer kleinen "Chance" ausgesetzt gewesen, mit Pflanzen konfrontiert zu werden, deren Genregulation aus der Bahn geworfen wurde; auch bei dem, was man als "neue Sorte" ausgesucht und vermehrt hat. Jede neue Sorte - egal ob gentechnisch oder nicht - trägt immer ein winziges Risiko, auf irgend eine Weise für uns schädlich zu sein. Aber im Großen und Ganzen hat die Züchtung neuer Sorten uns unendlich viel mehr genützt als uns - in ganz seltenen Fällen - geschadet. Und außerdem: Egal, ob in einer Pflanze nun die Regulation falsch, richtig, anders, normal, verdreht, verquer, kopfüber oder wie immer läuft; es ist völlig belanglos. Es bedeutet nämlich noch lange nicht, dass es schlecht für unsere Gesundheit sein muss, so wie uns das Grünlinge ohne Unterlass suggerieren wollen. Was für die Pflanze zum Nachteil ist, kann für uns sogar zum Vorteil sein. Weshalb müssen denn die meisten Kulturpflanzen von uns gehegt und gepäppelt werden? Weil sie sonst kaum eine Chance hätten sich zu verbreiten, eben weil oft irgend was die Regulation betreffend verändert ist. Grünlinge täuschen Laien ganz bewusst. Wie sie dabei vorgehen, hat ein Herr Ludger Wess sehr schön mal an einem Beispiel im Blog "Die Achse des Guten" aufgezeigt. Hätte es nämlich die Grünlinge schon Mitte des 18. Jahrhunderts gegeben, als die Kartoffel in Deutschland unter Zwang als Nahrungsmittel eingeführt wurde, dann hätte ihre Parole statt "Gen-Dreck weg" damals gelautet: "Kartoffel-Dreck weg" [3].

Zurück zum ersten Zitat aus dem Artikel von Grünlings-Meinung: Das mag wissenschaftlich und kompetent für Laien klingen. Lassen Sie sich bitte davon und auch nicht vom Rest der Behauptungen beeindrucken, falls Sie unbedingt den kompletten Artikel der Kritiker lesen möchten. Der ist nach dem gleichen einseitigen Schema gestrickt. Und wundern Sie sich auch nicht, wenn die Kritiker so tun, als würde Gentechnik gar nicht zur Züchtung zählen, sondern irgend etwas Abartiges sein. Tatsächlich ist Pflanzen-Gentechnik einfach seit 30 Jahren eine zusätzliche Züchtungsmethode. Und die ist nochmals in den letzten paar Jahren so enorm verbessert worden, dass der heilige Bürokratius, seine Definition von Gentechnik nun angestrengt überdenken muss.

Die Schlussfolgerung zu der sich die grünlichen Kritiker am Ende ihres Artikels hinreißen lassen, möchte ich Ihnen nicht vorenthalten:

...Der dauerhafte, nicht rückholbare Eintrag gentechnisch veränderter Organismen in die Umwelt ist nicht verantwortbar und sollte deswegen verboten sein.

Nach allem, was ich Ihnen erklärt habe, wäre es nun wahrhaft legitim den Satzteil "gentechnisch veränderter Organismen" durch die Worte "von Mutanten-Organismen" auszutauschen. Der Satz lautet dann:

.Der dauerhafte, nicht rückholbare Eintrag von Mutanten-Organismen in die Umwelt ist nicht verantwortbar und sollte deswegen verboten sein.

Was würde passieren, nähmen wir tatsächlich den Vorschlag ernst? Wir müssten ein Drittel unserer heutigen Kultursorten einstampfen. Vor allem die wichtigsten Getreidesorten für unsere Grundversorgung wären betroffen. Die daraus resultierenden katastrophalen Folgen, überlasse ich mal Ihrem Vorstellungsvermögen.

 

 

Zum Nachschauen oder zur Ergänzung:

[1]testbiotech.org. [2] Carsten Bresch und Rudolf Hausmann: Klassische und Molekulare Genetik. Springer Verlag. Berlin, Heidelberg, New York. 1970. Seite 326. [3]www.achgut.com/dadgdx/index.php/dadgd/print/0035905.[4] Bei vielen Genen kommt es erst gar nicht zur Bildung von Eiweißen (Proteinen / Enzymen), sondern der Fertigungsprozess bleibt bei einem Zwischenprodukt - der Ribonukleinsäure, abgekürzt RNS (engl. RNA) - stehen. Darüber werden Sie in meinem Blog kaum was finden; schauen Sie bitte im Internet nach. [5] Schauen Sie bitte im Internet nach.

 

 

Nicht vergessen:

► Bei Mutantenzüchtung (aber auch bei Kreuzungszüchtung) entsteht eine unübersehbare Vielzahl an Nachkommen; nicht so bei der gentechnischen Züchtung. Mutantenzüchtung erweitert aber erfolgreich die "natürliche" Auslese-Züchtung. Beitrag 07.

► Zufällige Verdrehungen und Einfügungen bei Mutationszüchtung, aber auch ganz "normale" Züchtung können den Sinn im Erbgut verändern. Beitrag 08.

► Im Jahr 2013 wuchsen weltweit schon mindestens 10 Billionen gentechnisch veränderter Pflanzen auf den Feldern. Beitrag 09.

► Ein Tabellarischer "Gefahren"-Vergleich von Züchtung mit und ohne Gentechnik. Beitrag 09.

► Grünlinge wollen uns ihre Vorstellungen von Natur und Technik aufzwingen. Beitrag 10

► Rat und Information sollte man sich immer bei kompetenten Fachleuten holen. Beitrag 11.

 

 

 

13.



...ein Geheim-Code...

 

Kodieren und dekodieren mal ganz einfach.

 

..tttgtcttac ctaattattt atttattgtc gtttggtaat aataaataac agttcatgtt tacaatatga tattttcctt attcatactt ggtatatgct ttattctcta gtgattctca ttacaaagat atttgtgcaa gtttggactc gtcccaaatc aagaaaaatg ttgtagtcaa aatgcttttc agttacgagt ctgaaacctg acaacacaaa attataaatt gtttttattt attttttcct aatcaaaacg attttttcct aatataaaat ttgatatttt gaggggtaaa agaagcaata attgagaata ttgagatact aaaattgtga cgagacgctt gatgggttcc acttaaatat ctgatatgat tacacgtggc agactatgct ccgtccctaa tgagcttcgt gtgattttga ttaattttgt taacttttat ttttgtcgtc...usw, usw,...

 

Nun, haben Sie die obige Reihenfolge von lauter a, c, g und t aus Beitrag 05 schon auswendig gelernt? Kleiner Scherz von mir! Vielleicht interessiert es Sie ja, wozu die Reihenfolge gut ist:

Es ist der Anfang eines Gens mit dem Namenskürzel "sbe2.1" von einem Pflänzchen namens Hirtentäschelkraut (Botanischer Name: Arabidopsis thaliana); das Gen besteht aus gut 6000 solcher Buchstaben und ist Teil eines DNA-Fadens, der noch mehr als 3000 mal länger ist und tausende anderer Gene enthält.

 

Aha???! wird vermutlich Ihre Reaktion lauten.

Nun da steckt in verklausulierter Form die Anleitung zum Bau einer bestimmten Eiweißsorte drin; diese hat katalytische Funktion, ist also ein Enzym und wird als "Stärke-verzweigendes Enzym" bezeichnet.

Aha???! wird vermutlich Ihre nächste Reaktion lauten. Was hat das mit Gentechnik zu tun?

Ja, so direkt nichts. Aber wir sind immer noch bei der Frage nach Risiken und Gefahren von Züchtung. Für mich ist die Antwort klar: Egal wie man züchtet. Risiken und Gefahren sind minimal. Wenn man überhaupt von Risiken sprechen will, dann liegen die eher in der herkömmlichen Züchtung. Aus meiner Sicht sind aber die Vorteile jeder Züchtungsart so überwältigend, dass man einfach und munter wie bisher weiterzüchten sollte. Mit jedem, was man von Jahr zu Jahr, von Jahrzehnt zu Jahrzehnt, mehr über Pflanzen dazu gelernt hat und dazu lernt, strebt das minimale Risiko sowieso weiter gegen Null.

Nun werden aber Risiken und Gefahren von den Grünlingen aufgeblasen. Ja, Risiken und Gefahren scheinen für Grünlinge sogar gegen Unendlich zu streben. So bleibt mir doch gar nichts anderes übrig, als die Frage nach Risiken und Gefahren an einem weiteren, vielleicht für den Laien gerade noch verständlichen Beispiel abzuarbeiten. Das Beispiel soll sich daher anders als in den Blogbeiträgen 07 und 08 den tatsächlichen Verhältnissen bei den Pflanzen und ihren Genen annähern.

Keine Bange, ich werde es Ihnen wieder mit einer Analogie verständlich machen.

Und sie wissen ja. Genauere, aber auch viel kompliziertere Antworten dazu finden Sie in Lehrbüchern, bei Wikipedia (je nach Thema ggf. mit eingeschaltetem Skepsis-Modus) und anderen nicht grünlich eingefärbten Webseiten.

Diesmal entwickeln wir eine "Geheimschrift", über die ein Computer-Hacker vielleicht mitleidig lächeln würde [4]. Egal. Das Folgende mag Ihnen zunächst etwas seltsam vorkommen. Denken Sie daran, es geht jetzt darum realistischer darzustellen, was Gene so machen und wie es durch natürliche Mutationen zu "gefährlichen" Peptiden kommen könnte. Die liebreizenden Mädels Emma, Eva und Nora aus Beitrag 08 haben uns einen ersten Eindruck vermittelt, wie man sich so etwas vorstellen kann. Wir wollen nun einmal Kurztexte oder Kurzbefehle mit Großbuchstaben schreiben und diese Großbuchstaben dann verklausulieren. Schauen Sie sich deshalb die folgende Tabelle an. Die Erklärung folgt nach der Tabelle.

 

"Geheim-Code"-Tabelle!

Code (Codon)

Buchstabe

Code (Codon)

Buchstabe

Code (Codon)

Buchstabe

Code (Codon)

Buchstabe

aaa

A

caa

Z

gaa

M

taa

Stopp

aac

A

cac

X

gac

M

tac

N

aag

B

cag

W

gag

L

tag

Stopp

aat

C

cat

U

gat

K

tat

Ö

aca

D

cca

N

gca

J

tca

T

acc

D

ccc

T

gcc

R

tcc

R

acg

E

ccg

R

gcg

E

tcg

U

act

C

cct

S

gct

K

tct

S

aga

F

cga

S

gga

P

tga

Stopp

agc

H

cgc

A

ggc

E

tgc

T

agg

B

cgg

Ü

ggg

E

tgg

U

agt

I

cgt

P

ggt

D

tgt

U

ata

K

cta

O

gta

C

tta

V

atc

L

ctc

Q(u)

gtc

E

ttc

W

atg

M/Start

ctg

P

gtg

A

ttg

Y

att

N

ctt

G

gtt

Ä

ttt

Z

 

Die Tabelle besteht aus acht Spalten. Unter der Überschrift "Buchstabe" stehen die Großbuchstaben unseres Alphabets in mehr oder weniger kunterbunter Reihenfolge. Links neben jedem Großbuchstaben unter der Überschrift "Code" finden Sie verschiedene Dreierfolgen [3] der kleinen Buchstaben a, c, g und t. Mit einer Dreierfolgen wird im Weiteren der rechts daneben stehende Großbuchstabe "verschlüsselt".

Möchte ich z.B. die Worte AHA, VERSTEHE verschlüsseln, könnte das so aussehen:

aaa agc cgc, tta acg ccg cct ccc gcg agc ggg oder, lässt man die Lehrzeichen weg, so:

aaaagccgc, ttaacgccgcctcccgcgagcggg; lässt man noch das Komma weg, dann so:

aaaagccgcttaacgccgcctcccgcgagcggg.

Ein großes A wird entweder durch aaa, aac, cgc oder gtg kodiert, ein H nur durch agc. Der Code besteht aus 64 verschiedenen Dreierfolgen. Diese sind in der Tabelle korrekt alphabetisch angeordnet um die Dekodierung zu erleichtern. Eine Dreierfolge wollen wir "Codon" nennen.

Die Dreierfolge bzw. das Codon atg hat gleich zwei Funktionen. Einmal steht es für den Großbuchstaben M, aber es soll in unserem Fall auch den Anfang eines Satzes anzeigen. A wie Anfang oder S wie Start wäre aus Ihrer Sicht vielleicht einprägsamer; aber wir nehmen hier einfach mal M. Weiter gibt es drei Codons, die uns das Ende eines Satzes signalisieren sollen. Rechts neben diesen Codons steht in der Tabelle statt eines Großbuchstabens das Wort "Stopp".

 

Im Folgenden wollen wir nur sehr kurze Sätze verklausulieren, z.B. so einen wie diesen hier: ZUCKER ABBAUEN. Als erstes stellen wir den Buchstaben M vor den Kurzsatz. Dann entfernen wir die Leerstellen zwischen den Wörtern oder wir ersetzen die Leerstellen durch beliebige Großbuchstaben. Und erhalten, wie im folgenden Beispiel: MZUCKERPWDABBAUEN.

Wir sollten noch darauf achten anstelle der Leerstellen keine sinnvolle Buchstabenfolge einzufügen. Also nicht so: MZUCKERDOSEABBAUEN, denn wir müssen aufpassen, den Sinn nicht zu verändern. Es soll ja der Zucker und nicht die Zuckerdose in Einzelteile zerlegt werden.

Um es gleich vorweg zu sagen, wir zerkleinern Zuckerkristalle nicht mit Hammer und Meißel, sondern Zucker-Moleküle sollen biochemisch in kleinere Stücke gespalten werden. Dazu in der Lage, sind in den Zellen der Lebewesen bestimmte Eiweiße - auch Enzyme genannt.

Zur Verwirrung von "Code-Knackern" könnten wir vorn und hinten noch weitere "sinnlose" Großbuchstaben anfügen; was wir aber der Einfachheit halber mal lassen.

Nun beginnen wir mit der eigentlichen Kodierung, also die Umschreibung in den Kleinbuchstaben-Code: Zuerst kommen die drei Buchstaben a,t, und g für Start, so dass jeder weiß, hier ist der Anfang des Satzes. Da die Folge atg auch für "M" kodiert, fängt jeder Satz auch immer mit einem M an. Dann kommt für Z die Buchstabenfolge t, t, t, also das Codon ttt. Wir verschlüsseln U mit tgg und C mit act. Schließlich erhalten wir die Sequenz:

atg ttt tgg act gct ggc ccg ctg ttc acc cgc agg agg aaa tcg gtg tac taa.

Das Ende wird mit taa (= Stopp) angezeigt. In der obigen Kleinbuchstaben-Sequenz habe ich das Start-Codon, die Codons für die zusätzlichen Großbuchstaben und das Stopp-Codon unterstrichen. Die fett markierten Codons ergeben den eigentlichen Sinn.

Zur Verwirrung von Code-Knackern fügen wir jetzt noch beliebig viele Kleinbuchstaben vorn und hinten (kursiv) dran. Und erhalten:

....cctgaatt atg ttt tgg act gct ggc ccg ctg ttc acc cgc agg agg aaa tcg gtg tac taa cgttgca.... Die Pünktchen sollen andeuten, dass es noch beliebig weitergehen könnte. Als letzten wichtigen Schritt entfernen wir alle Leerzeichen und Unterstreichungen und schreiben alle Buchstaben auf die gleiche Weise. Das Resultat sieht dann so aus:

....cctgaattatgttttggactgctggcccgctgttcacccgcaggaggaaatcggtgtactaacgtctat.... Fertig. Wir bezeichnen diese Reihenfolge im Folgenden als "Original-Code-Sequenz". An der wollen wir später Veränderungen, also "Mutationen", vornehmen.

Aber zuerst zur Kontrolle die Rückübersetzung. Wir beginnen links und suchen nach dem ersten "atg". Wir wissen, jeder Satz sollte mit einem atg ( = M) anfangen. Dann greifen wir im Dreier-Raster die Codons ab. Als erstes folgt ttt, laut Code-Tabelle also Z. Dann tgg = U, act = C, usw. bis uns schließlich taa das Ende des Satzes signalisiert.

Rückübersetzt sieht die Rohfassung der ersten Anweisung dann so aus:

...cctgaattMZUCKERPWDABBAUENtaa.... Wir finden die Worte ZUCKER und ABBAUEN wieder. Die Kleinbuchstaben, die wir nicht rückübersetzen brauchen, lassen wir einfach mal so stehen.

Ich hoffe, dass war nicht zu schwer für Sie. Daher - gemein wie ich nun mal bin - verlängere ich die Original-Sequenz mit folgenden Kleinbuchstaben:

...tccggcaactgcaatggccggaccgctaacctgtatacccggcgtgtggtcttctgtaagcatcgt

ccgagagacgtggtcggggattgtagtaaagtag...

und wir erhalten insgesamt:

 

 

....cctgaattatgttttggactgctggcccgctgttcacccgcaggaggaaatcg

gtgtactaacgtctattccggcaactgcaatggccggaccgctaacctgtataccc

ggcgtgtggtcttctgtaagcatcgtccgagagacgtggtcggggattgtagtaaagtag....

Die Original-Sequenz habe ich fett gedruckt, die neue Sequenz ist normal geschrieben. Lassen Sie sich durch Zeilenumbrüche nicht verwirren, alle Kleinbuchstaben sollen direkt aufeinander folgen. Zwischen einem Stopp (hier: taa, Original) und dem nächsten Start-Codon (hier: atg, neue Sequenz) brauchen wir auf das Dreier-Raster keine Rücksicht nehmen. Erst dann, wenn wir nach einem Stopp-Codon eine atg-Folge entdecken, erst dann ist das unser neuer Startpunkt, um mit dem Entschlüsseln des nächsten Satzes zu beginnen. Wenn wir also - wie in unserem Beispiel um "Hacker" zu verwirren 20 beliebige Kleinbuchstaben zwischen die Sätze einfügen, dann darf eine atg-Folge erst nach dem 20. Buchstaben auftreten. Wenn sie nun die nächste Anweisung ab diesem atg zurückübersetzen, dann wissen Sie, was nach dem Zuckerabbau mit den entstandenen Bruchstücken geschehen soll, nämlich:

...gcaactgcaMRPRODUKTEAUSSCHLEUSENCCBtag....; sinnvoll für uns sind die Buchstabenfolgen PRODUKTE und AUSSCHLEUSEN oder in gefälligem Deutsch: Transportiere bitte die gespaltenen Zuckerbausteine aus der Pflanzenzelle heraus.

 

Im Prinzip könnten wir mit unserem Code nun beliebige Satzfolgen durch endloses Aneinanderreihen von a, c, g, und t verschlüsseln. Keine gute Methode, um Bücher zu kodieren. Die würden dann mindestens dreimal so dick und müssten alle dekodiert werden. Wozu also das Ganze?

 

Wie in Beitrag 05 erwähnt, haben Biochemiker die vier verschiedenen Molekülbausteine der DNA-Fäden abgekürzt mit den vier Buchstaben a, c, g und t bezeichnet. Die Reihenfolge dieser Bausteine wird als genetischer Code bei allen Lebewesen in der gleichen Weise benutzt [8]. So wie wir in unserem Beispiel aus den Dreier-Codons die Großbuchstaben aneinanderfügen müssen, um dann Sätze oder besser gesagt kurze Anweisungen zu bekommen, so werden in den Zellen anhand der acgt-Abfolge in den DNA-Fäden Eiweißketten zusammengebaut. Die Molekülbausteine für die Eiweiße heißen Aminosäuren. Davon gibt es 20 verschiedene. Bestimmt kennen Sie eine Aminosäure mit Namen. Es ist die "Glutaminsäure", ein Geschmacksverstärker. Sie finden ihren Namen häufig im Kleingedruckten auf Speisekarten. Abgekürzt wird Glutaminsäure mit "Glu"; wenn es nicht zu Verwechslungen kommen kann, manchmal auch nur mit "G". Wer besonders gesundheitsbewusst lebt, der kann die essentiellen Aminosäuren R, H, I, L, K, M, F, T, W, V sicherlich ohne Zögern aufsagen [1].

Manchmal enthalten "Genetische Code"-Tabellen nicht die vollständigen Namen der Aminosäuren oder die Dreierkürzel, sondern nur die Einbuchstaben-Abkürzungen. So eine genetische Code-Tabelle sieht dann unserer Tabelle oben recht ähnlich. Übertragen auf unser Beispiel würde eine bestimmte Aminosäure eben einem Großbuchstaben entsprechen und ein Eiweiß würde einem Kurzsatz oder einer Anweisung, einem Befehl entsprechen.

Im Unterschied zu unseren Kurzsätzen sind Eiweiß-Ketten in der Regel sehr viel länger. Im Gegensatz zu unserem Beispiel, wo die Sätze UNS ja nur sagen, was WIR tun sollen, führen die fertigen Eiweiße in den Zellen die Befehle auf wunderbare Weise auch gleich aus. Eiweiße sind beides zugleich: "Befehl und Vollstrecker" oder - weniger martialisch - "Anweisung und automatisch arbeitende Spezialmaschine" oder noch anders "Anleitung und Spezialkatalysator". Wirklich fantastisch! Diese biologischen Katalysatoren heißen Enzyme. Enzyme sind Eiweiße oder - was das gleiche ist - Proteine. So ist es bei Mensch, Mikrobe, Tier und Pflanze.

Und das macht sich die Gentechnik zu nutze:

Da sagt nämlich der Konsument zum Händler, die Früchte könnten ruhig etwas süßer sein. Der Händler sagt's dem Landwirt und der redet mit dem Züchter. Der Züchter setzt sich mit Biochemikern und Pflanzenphysiologen zusammen. Alle drei beraten, was man denn da machen könne.

Wieso spaltet diese blöde Pflanze den Zucker und transportiert die Produkte anschließend auch noch hinaus? Könnte man nicht die Pflanze dazu bringen, wenigsten einen Teil des Zuckers zu speichern?

Gesagt, getan. Was liegt näher als Gentechnik anzuwenden. Das ist schneller als jede andere Züchtungsmethode. Wir brauchen nur eine kleine Anweisung zu schreiben. Erinnern Sie sich noch an den Textstreifen des Gentechnikers in Raum Nr. 1 im Beitrag 07? Eine Textband-Minimalausgabe könnte etwa so aussehen:

atgcaatcggtagatggggccagttacagatcctgtgtaagctcatccacgagttactga.

Das müsste man nur einfach ins Erbgut einer Zelle stecken, daraus ein Pflänzchen ziehen und schon wäre die Frucht vielleicht ein wenig süßer!

Sie müssen nicht in der "Geheim"-Tabelle nachschlagen. Ich sage Ihnen, welcher Kurzsatz hier kodiert ist.

Bei atg fängt's an, dann im Dreierraster weiter bis zum tga (= Stopp):

atg caa tcg gta gat ggg gcc agt tac aga tcc tgt gta agc tca tcc acg agt tac tga.

Und heraus kommt: MZUCKERINFRUCHTREIN. Also: Zucker in Frucht rein. [2]

Na, vielleicht gelangt ja jetzt ein Teil des Zuckers in die Frucht, bevor der Zucker gespalten wird und die Spaltprodukte heraustransportiert werden. Und vielleicht verkraftet das die Pflanze ja auch ganz gut. Sie wächst vielleicht ein wenig langsamer und ist ein bisschen kleiner. ABER: Hat süßere Früchte. Das Erbgut ist gegenüber der Ausgangssorte, ansonsten nicht verändert. Wenn sie uns vorher nicht geschadet hat, wird sie uns mit allergrößter Wahrscheinlichkeit auch jetzt nicht schaden.

 

Wenn Ihnen die Verschlüsselung Spaß macht, können Sie natürlich für sich die Code-Tabelle beliebig verändern und auch noch Zahlen und Sonderzeichen verschlüsseln. Übrigens Sonderzeichen, das gibt es auch auf der DNA. Die findet man aber nicht in der Code-Tabelle. Die sind extra aufgelistet in Spezialtabellen oder gar nur in der Orginalliteratur zu finden. Sonderzeichen haben u.a. auch was mit der Regelung oder besser mit der Regulation zu tun. Erinnern Sie sich noch an das Zitat des überkritischen Gentechnik-Kritikers in Beitrag 12? Auf dieses Zitat kommen wir auch gleich noch mal zu sprechen.

 Nein, jetzt höre ich auf, Sie mit zusätzlicher Information zu nerven. Schließlich ist es im Moment wichtiger, sich klar zu machen, wie natürliche Mutationen zu anormalen und vielleicht sogar giftigen Peptiden führen können.

Ich hoffe, Sie sind nicht zu erschöpft, denn jetzt kommt das, wo Grünlinge genau hingucken sollten. Was sie aber nicht tun. Was sie nicht kapieren wollen oder wenn sie es denn kapieren, nicht wahr haben wollen. Denn es kann ja nicht sein, was nicht sein darf.

 Wie im Beispiel mit dem gemütlichen Stelldichein auf der Burg (Beitrag 08) wollen wir beim "Zuckerabbau-Beispiel" einmal eine ganz "natürliche", völlig "natürliche", absolut "natürliche" Mutation simulieren, so wie es in einer Pflanzenzelle (ohne Gentechnik, ja selbst ohne Mutanten-Schrotschuss-Technik) ablaufen könnte. Dazu drehen wir den unterstrichenen Teil in der Mitte um. Wie nennen wir so eine Mutation mit ihrem Fachausdruck? Richtig! Inversion!

Zur besseren Übersicht hier nochmal die Original-Sequenz mit Leerstellen, um die Dreier-Codons gut zu erkennen:

...cctgaatt atg ttt tgg act gct ggc ccg ctg ttc acc cgc agg agg aaa tcg gtg tac taa cgttgca....

Und jetzt die Inversion. Das Ganze sieht dann so aus:

...cctgaatt atg ttt gct aaa gga gga cgc cca ctt gtc gcc cgg tcg tca ggt gtg tac taa cgttgca.... Die unterstrichenen Buchstaben in der Mitte laufen nun in umgekehrter (!) Richtung!.

Nun entschlüsseln wir anhand unser Code-Tabelle die umgedrehte Version wie vorgeschrieben von links nach rechts. Wir beginnen beim ersten atg und übersetzen bis zum ersten Stopp-Codon. Wir erhalten - wenn ich keine Fehler gemacht habe - die Rohfassung: ...cctgaattMZKAPPANGERÜSTEDENtaacgttgca.....

Das ergibt sogar eine sinnvolle Anleitung, ein Befehl: KAPP GERÜSTE [5]. Was aber passiert wohl in der Zelle, wenn durch eine Inversion, also eine "völlig natürliche" Mutation, plötzlich eine Anleitung zum kappen eines molekularen Zellgerüstes zu völlig unpassender Zeit erscheint? Erinnern wir uns an Beitrag 12. Da scheint ja was völlig außer Kontrolle geraten zu sein! Und das sollte doch eigentlich nach Grünlings Märchenstunde nur bei Gentechnik passieren. Nur bei Gentechnik sollte doch die Regulation aus dem Ruder laufen. Hier zur Erinnerung - auch wenn es nervt - das Grünlings-Zitat: "...kann durch die Methode des Gentransfers ungewollt auch die Aktivität anderer Gene und der Stoffwechsel der Pflanzen verändert werden...".

Wir können es uns jedenfalls nun sehr gut vorstellen, dass dieses Zitat auch auf natürliche Mutationen passt. Dadurch, dass nun Gerüste gekappt werden, kann sicherlich auch so was wie z.B. die Regulation anderer Gene und der Stoffwechsel in Mitleidenschaft gezogen werden.

Aber das Wort "Mutation" verkneifen sich Grünlinge wohl weislich, wenn Sie ihre Behauptungen in die Welt posaunen. Wenn schon, dann müsste es zumindest so lauten:"...kann durch die Methode des Gentransfers und insbesondere durch natürliche Inversionen [6] ungewollt auch die Aktivität anderer Gene und der Stoffwechsel der Pflanzen verändert werden...".

Weist man darauf hin, dann folgt, Sie können es sich sicher schon denken, mit naiver Unverfrorenheit wieder die Behauptung: Mutationen sind "natürlich", ganz im Gegensatz zur Gentechnik".

Als ob das einen Unterschied machen würde, wodurch nun etwas aus dem Ruder läuft. Was für eine arglistige Täuschung.

 

Bleiben Sie bitte nur noch einen Moment. Lassen Sie mich bitte schnell noch eine andere Art von Mutation ansprechen, die sich durch eine winzige Veränderung einschleichen kann. Wieder nehmen wir die Original-Code-Sequenz:

...cctgaatt atg ttt tgg act gct ggc ccg ctg ttc acc cgc agg agg aaa tcg gtg tac taa cgttgca.....

Wir lassen jetzt nur einen einzigen Buchstaben weg und zwar das mit einem Unterstrich markierte a. Das deuten wir in der folgenden Sequenz durch einen Punkt (.) an und erhalten:

...cctgaatt atg ttt tgg . ctg ctg gcc cgc tgt tca ccc gca gga gga aat cgg tgt act aac gtt gca....

Wieder greifen wir vom atg aus im Dreier-Raster ab. Es zählen nur die Buchstaben, nicht der Punkt. Das ganze Dreier-Raster ist verrutscht. Auf das Codon tgg folgen nun sofort die drei Buchstaben ctg, denn es fehlt ja nun das a. Wir schlagen in unserer Geheim-Code-Tabelle nach und dekodieren. Wir erhalten jetzt eine lange Großbuchstabenfolge:

...cctgaattMZUPPRAUTTJPPCÜUCAÄJ...usw.....

Weil im neuen Dreier-Raster die ursprüngliche Folge taa (für Stopp) nun aufgeteilt und daher nicht erkannt wird, müssten wir so lange Großbuchstaben gemäß der Tabelle anfügen, bis wir im neuen Dreier-Raster zum nächsten Stopp-Codon gelangen. Wir erinnern uns, es gibt drei davon. Aber das lassen wir jetzt mal.

Beachten Sie: Das alles hat mit Gentechnik nichts zu tun. Und beachten Sie weiter:

So führt eine winzige Veränderung, eine "Mini"-Deletion in der Original-Sequenz zu einer Übersetzung, die für UNS kein sinnvolles Wort, keine sinnvolle Anleitung ergibt. WIR wissen nicht, was zu tun ist.

ABER: Würde in einer Pflanze Ähnliches ablaufen und auf vergleichbare Weise ein "anormales", quasi "artfremdes" Eiweiß entstehen, dann könnte das sehr wohl eine Anweisung ergeben. Wir erinnern uns: Ein Eiweiß kann Anleitung und Spezialkatalysator (Enzym) zugleich sein. Bei einem solch "anormalen" Eiweiß, können wir nicht so ohne weiteres erkennen, ob es nun in der Zelle Unfug treiben wird oder nicht. Als Molekularbiologe fallen mir da viele Möglichkeiten ein, was dieses völlig neue, abartige Protein alles anstellen könnte. Wir könnten uns auch ins Land der Grünlings-Fantastereien begeben und Behauptungen aus der Tabelle 1 in Beitrag 9 herumposaunen oder nach Grünlingsmanier mit Fachausdrücken zusammenhanglos um uns werfen, nur um Leute wie Tante Olga, Onkel Paul und den Neffen Karl (Blogbeitrag 1) zu beeindrucken und zu verängstigen. Wie wär's mit ein paar Beispielen? All das Folgende könnte verrückt spielen, ganz ohne Gentechnik, wenn durch Zufall ein solches völlig neues, abartiges Protein gebildet würde: Epigenetik; Chromatin- und Chromosomenstruktur; Replikation; Exon-Intron-Grenzen samt alternativem Spleißen; Transport; Initiation, Elongation und Termination der Translation; Transkriptionskomplexe; Proteinmodifikation; regulatorische RNAs; Zellzyklus; Differenzierung; MADS-Box-Proteine; homeotische Gene; Protonen-Pumpen; und so weiter und so fort. Vergessen wir nicht, die Umwelt! Was könnte dieses Eiweiß nicht alles mit der übrigen Fauna und Flora anstellen, sollten die Nachkommen dieser Pflanze nun anfangen zu wuchern und sich ungehemmt überall verbreiten. Und nochmal: All das, ganz ohne Gentechnik!

Nein, keine Angst. Ich werde nicht mit erhobenem Zeigfinger verkünden: "Mutagenese muss verboten werden". Nein, ich werde auch niemanden auffordern zu spenden, um die Natur zu besänftigen. Oh, ...da bin ich wohl vom Thema abgekommen.

Merken wir uns lieber und freuen uns mit all jenen, denen die Mutantionszüchtung eine nie dagewesene Vielfalt an Nahrungsquellen erschlossen hat. Mutantionszüchtung ist eine der Grundlagen für eine erfolgreiche, "natürliche", aber auch oft viel zu viele Jahre in Anspruch nehmende Auslese-Züchtung.

Bei Mutantionszüchtung, die fast immer auch mit Kreuzungen kombiniert wird, entstehen zunächst die unterschiedlichsten Nachkommen. Wenn da so Tausende bis Zehntausende einzelne Pflänzchen heranwachsen, kann kein Züchter auf ein Pflänzchen zeigen und sagen: "Aha, da bist du ja, ich sehe dir an, das du das Pflänzchen bist, das süßere Früchte haben wird als die anderen."

Nur in wenigen Fällen, kann er auf Anhieb freudig sagen: "Du da hinten in der Pflanzschale Nr. 17 in Position A6, du bist genau die, die ich als Ausgangspflanze für meine neue Sorte brauche!" Ein Beispiel dafür wäre die Suche nach pilzresistenten Kultursorten. Da kann man tatsächlich diejenigen Pflänzchen schon sehr früh erkennen, die munter und unbeeinflusst in pilzverseuchten Kulturschalen hochwachsen.

Und nochmal zur Wiederholung: Die herkömmlichen Mutationszüchtungen und die bei Grünlingen über alle Maßen beliebten Kreuzungszüchtungen bescheren uns zunächst eine riesige Menge an Nachkommen mit einer unübersehbaren Zahl von Veränderungen und Neukombinationen im Erbgut. Und daher unterscheiden sich alle, was die unterschiedlichsten Eigenschaften betrifft, auch mehr oder weniger deutlich voneinander [7].

Anders bei gentechnischer Züchtung. Man erhält, wenn's hochkommt, einige Dutzend Pflanzen mit der gewünschten neuen Eigenschaft. Aus den wenigen Pflanzen wählt man dann noch die aus, die sich von der Ausgangskultursorte ansonsten am wenigsten unterscheiden. So einfach ist das.

 

 

Zum Nachschauen oder zur Ergänzung:

[1] R = Arg = Arginin, H = His = Histidin, I = Ile = Isoleu, L = Leu = Leucin, K = Lys = Lysin, M = Met = Methionin, F = Phe = Phenylalanin, T = Thr = Threonin, W = Trp = Tryptophan, V = Val = Valin. Diese Aminosäuren müssen mit der Nahrung aufgenommen werden. Die kann unser Körper nicht selbst herstellen. Das ist nur die Hälfte der Aminosäuren aus denen Eiweiße zusammengesetzt sind. Information über Aminosäuren können Sie in Lehrbüchern finden. Da können Sie sogar auf den Webseiten der Grünlinge nachschlagen und finden vernünftige Auskunft; allerdings sollten bei Ihnen die Alarmglocken schrillen, wenn dort im gleichen Atemzug Gentechnik erwähnt wird. [2] Natürlich ist es in Wirklichkeit komplizierter, weil man noch einiges mehr zu beachten hat. In dieser Analogie habe ich die Tatsache weggelassen, dass die DNA in der Zelle doppelsträngig vorliegt und dass zur Bildung der Eiweiße eine Zwischenstufe, die RNA, nötig ist. Das Prinzip aber ist richtig. [3] Dazu sagt man auch: Triplett. [4] So ganz abwegig ist diese Art der Verschlüsselung nicht. Es gibt tatsächlich Überlegungen elektronische Texte mit Hilfe von synthetischen DNA-Molekülen in ähnlicher Weise abzuspeichern und zu konservieren. Aufgereinigte, getrocknete DNA ist nämliche unter normalen Bedingungen tausendmal haltbarer als CDs, DVDs und ähnliches. [5] Ich hoffe, ich habe mich bei all dem Tabellieren, Kodieren und Dekodieren nicht vertan. Ich habe aber jetzt auch keine Lust mehr, alles noch einmal zu prüfen. Es geht hier um's Prinzip. Das ist wichtig! [6] und viele andere Mutationsarten. [7] Zur Erinnerung: Ich argumentiere hier pauschal. Detaillierte und viel umfangreichere Information finden Sie in Lehrbüchern über Genetik und moderne Züchtung. (Und ich bin mir ziemlich sicher, dass sich Grünlinge mit solchen Büchern nie intensiv beschäftigt haben; wenn überhaupt, haben sie sie als Quelle für beeindruckende Fachausdrücke benutzt). [8] bis auf vereinzelte minimale Abweichungen

 

 

Nicht vergessen:

► Zufällige Verdrehungen und Einfügungen bei Mutationszüchtung, aber auch ganz "normale" Züchtung können den Sinn im Erbgut verändern. Beitrag 08.

► Im Jahr 2013 wuchsen weltweit schon mindestens 10 Billionen gentechnisch veränderter Pflanzen auf den Feldern. Beitrag 09.

► Ein Tabellarischer "Gefahren"-Vergleich von Züchtung mit und ohne Gentechnik. Beitrag 09.

► Grünlinge wollen uns ihre Vorstellungen von Natur und Technik aufzwingen. Beitrag 10

► Information sollte man sich eigentlich bei bei kompetenten Fachleuten holen. Beitrag 11.

► Lassen Sie sich nicht durch "kluges" Geschwätz verängstigen. Egal ob gentechnisch, herkömmlich oder "Bio": Die Regulation und das Stoffwechselgleichgewicht kann bei jeder Pflanze aus dem Gleichgewicht geraten: Solange die Pflanze uns schmeckt und bekömmlich ist, ist es völlig belanglos. Beitrag 12.

 

 

 

 

14.



...Art, Art, Art...und ganz natürliche Gentechnik...

 

Ich hoffe, ich konnte Ihnen in Beitrag 13 andeuten, wie im Prinzip Lebewesen ihre Information verschlüsseln und was passieren kann, wenn sich in den verschlüsselten Code Fehler (Mutationen) einschleichen. Dann nämlich kann sich das unter Umständen bei der Entschlüsselung bemerkbar machen.

Ganz "natürlich" können Mutationen die Lebensvorgänge in völlig unberechenbarer Weise stören. Und das viel häufiger als bei Gentechnik!!! Stören durch Mutation kommt immer und überall vor, in Mikroben, Pflanzen, Tieren, und Menschen. Denken sie nur an die vielen Erbkrankheiten, mit denen sich Menschen seit Urzeiten herumschlagen müssen. Krebs ist eine Folge solch völlig natürlicher Mutationen, da läuft dann traurigerweise einiges mit der Regulation schief. Den Pflanzen geht's nicht besser; ein bisschen vielleicht. Das hat mit Gentechnik nicht das Geringste zu tun.

Die Lieblingsbehauptung von Grünlingen, die auch einem arglosen Nicht-Biologen sehr einleuchtend erscheint, ist die, wo es um Arten (Spezies) geht: Gentechnisch veränderte Pflanzen bedrohen "natürliche" Arten, weil sie sich ja mit denen kreuzen könnten. Dann wäre die Schöpfung und die Welt bedroht, weil sich überall veränderte Gene verbreiten.

Sie erinnern sich noch an Beitrag 13? Dort haben wir kurze Anweisungen in Großbuchstaben geschriebenen, wie z.B. "Zucker spalten", "Produkte ausschleusen" oder "Zucker in Frucht rein". Nun wird jeder erkennen, dass es sich um Worte aus der deutschen Sprache handelt. Was aber, wenn sich Tippfehler eingeschlichen haben oder ein ähnlich klingendes Wort aus dem Niederländischen oder Englischen mit der gleichen Bedeutung verwendet wurde. Glauben Sie, dadurch wird der Sinn so sehr verändert, dass Sie die Anweisung nicht verstehen. Denken Sie mal an die "verhundsten" Anleitungen, die Sie ab und an mit einem im fernen Ausland produzierten Gerät bekommen. Selbst damit wird man schon irgendwie zurecht kommen, denken SIE vielleicht. Aber wahrscheinlich denken Sie das auch nur, weil SIE kein Grünling sind.

So wie es im Mittelalter Hexen gab und Teufelsaustreibungen an der Tagesordnung waren, so sind Grünlinge felsenfest davon überzeugt, dass es Hexen und Teufelswerk ist, wenn wir ein paar wenige kurze Anleitungen aus einer Art nehmen und in eine andere Art stecken. Dabei vergessen sie oder sagen es nicht laut, dass die genetische Sprache nicht nur unter verwandten Arten verständlich ist, sondern sogar unter Arten, denen Sie, lieber Leser, jegliche Verwandtschaft miteinander abstreiten würden. Um nur drei völlig willkürliche Kombinationen zu nennen: Mensch und Hefe oder Joghurt-Bakterien und Karotten oder Reis und Maiglöckchen alle sind zumindest ein bisschen verwandt. Tatsache ist: Die genetische Sprache, genauer: Die Kodierung der Eiweiße mittels eines DNA-Dreier-Codes ist universell. So wie Sie mit der Tabelle in Beitrag 13 ganz leicht englische, niederländische, italienische Worte mit den Kleinbuchstaben a, c, g und t verschlüsseln können, so machen das die Lebewesen mit ihren Eiweißen (Proteinen, Enzymen). Sie übersetzen die acgt-Folgen auf den DNA-Fäden in Eiweiße. Das Erstaunliche an der Sache ist: Die Eiweiße, die die gleiche Aufgabe haben, sehen sich meist - aber nicht immer - ähnlicher, je enger die Lebewesen, die Arten, die Spezies miteinander verwandt sind. Als das den Systematikern unter den Biologen seit den 60er, 70er Jahren immer klarer wurde, drehten sie den Spieß um. Sie verglichen von da an die Abfolgen der Aminosäure-Bausteine von allen möglichen Proteinen und nahmen die Ähnlichkeiten als Maß, um Arten einander zuzuordnen.

 

Kommen wir zurück zu unseren Kurzanleitungen; nehmen wir als Beispiel die Anweisung "Zucker in Frucht rein" (aus Beitrag 13). Wir ersetzen einen Teil der Anleitung durch ein oder mehr fremde Wörter, wie z.B.:

1. Sugar in Frucht rein. 2. Suiker in Vrucht erin. Die Anleitungen sind sicher immer noch verständlich.

Schreiben wir diese Kurzanleitungen in der in Beitrag 13 verwendeten Großbuchstabenschrift genau untereinander, kann man sehr schön Veränderungen und Ähnlichkeiten erkennen:

ZUCKERINFRUCHTREIN

SU.GARINFRU.ITREIN

SUIKERINVRUCHTERIN

So ähnlich sehen auch die Vergleiche aus, die man mit den Aminosäure-Folgen von Eiweißen anstellen kann. Immer dann, wenn sie gleiche Aufgaben haben, dann sehen sich die Abfolgen verblüffend ähnlich. Und meistens gilt: Je enger verwandt zwei Arten sind, desto ähnlicher die Aminosäure-Folgen.

Wenn ich Sie jetzt frage: Glauben Sie es gibt Eiweißsorten, die sowohl in einer Pflanze als auch in einem Tier oder einem Menschen vorkommen? Was würden Sie antworten?......?...........?

Ich sag Ihnen, wie die Anwort lautet: Ja! Eine ganz Menge Proteine zeigen mehr oder weniger deutliche Übereinstimmung zwischen Tier und Pflanzen. Um nur ein ganz bemerkenswertes Beispiel zu nennen, hier mal die Reihenfolge der 103 Aminosäure-Buchstaben von einem kurzen Protein, das die Forscher "Histon H4" genannt haben. Das Eiweiß ist ein Chromosomen-Baustein. Dort findet man es in großen Mengen.

Wir vergleichen nun Mensch mit Kuh und Erbse! Sie haben richtig gelesen, wir vergleichen dieses Eiweiß aus den Menschen mit Kuh und Erbse! Damit es übersichtlicher ist, zunächst die ersten 51 und dann die letzten 52 Aminosäuren.

 

Mensch: M SGRGKGGKGL GKGGAKRHRK VLRDNIQGIT KPAIRRLARR GGVKRISGLI

Kuh:      M SGRGKGGKGL GKGGAKRHRK VLRDNIQGIT KPAIRRLARR GGVKRISGLI

Erbse:   M SGRGKGGKGL GKGGAKRHRK VLRDNIQGIT KPAIRRLARR GGVKRISGLI

 

Mensch: YEETRGVLKV FLENVIRDAV TYTEHAKRKT VTAMDVVYAL KRQGRTLYGF GG

Kuh:      YEETRGVLKV FLENVIRDAV TYTEHAKRKT VTAMDVVYAL KRQGRTLYGF GG

Erbse:   YEETRGVLKI FLENVIRDAV TYTEHAKRKT VTAMDVRYAL KRQGRTLYGF GG

 

Frappant die Ähnlichkeit, nicht wahr? Zwischen Mensch und Kuh kein Unterschied! Und nur zwei Buchstaben sind bei der Erbse anders! Ich hab' sie unterstrichen. Die meisten Eiweißtypen sind nicht so ähnlich wie in diesem Fall; bei manchen stimmen vielleicht nur noch ein Drittel der Buchstaben überein. Manchmal fehlen auch Teile, so dass die Längen nicht mehr übereinstimmen. Gerade so wie in unserem Satzbeispiel "Zucker in Frucht rein" weiter oben. Aber immer gibt es kurze Abschnitte auf denen noch dieselben Buchstaben zu finden sind.

Dazu ein weiteres Beispiel, das Sie auch gerne überspringen können.

Es ist ein Eiweiß (ein Enzym) von dem Sie sicherlich noch nie gehört haben, obwohl es eine der häufigsten oder sogar die häufigste Eiweißsorte der Welt ist. Es kommt nur bei Pflanzen vor und hat etwas mit deren Fähigkeit zu tun, das Kohlendioxyd (CO2) der Luft aufzunehmen und zu verwerten. Es hat einen ziemlich langen Namen [1]; abgekürzt wird es Rubisco genannt. Wenn Sie auch noch den Namen des dazugehörigen Gens wissen wollen: RbcL.

Klar, lasse ich wieder eine ganze Menge Information weg. Detaillierte Information gibt's z. B. in Büchern über Biologie, Biochemie und Pflanzenphysiologie oder im Internet.

Schauen Sie sich nun wieder die Reihenfolgen der Aminosäure-Buchstaben an und vergleichen Sie. Betrachten Sie es einfach als Suchbildaufgabe aus einem Rätselheft, bei dem sie die Unterschiede finden sollen. Hier habe ich nur die Reihenfolge der ersten 45 Aminosäure-Bausteine von insgesamt 475 aufgelistet:

aus Pappel:   MSPQTETKTGVGFKAGVKEYKLNYYTPEYETKDTDILAAFRVTPQ...

aus Spinat:   MSPQTETKASVGFKAGVKDYKLTYYTPEYETLDTDILAAFRVSPQ...

aus Grünalge: MSPQTETKARVGFKAGVKDYRLTYYTPDYQPKDTDILAAFRMTPQ...

 

Diesmal vergleichen wir drei Pflanzen: Alge, Spinat und Pappel. Selbst einer der von Biologie wenig Ahnung hat, wird zugeben müssen, dass die Pflanzen selbst wohl unterschiedlicher kaum sein können und völlig verschiedenen Arten angehören müssen. Obwohl es sich um ganz unterschiedliche Arten handelt, ist jedoch die Reihenfolge der Aminosäuren in diesen Rubisco-Molekülen immer noch verblüffend ähnlich.

Was für Rubisco gilt, gilt für zehntausende verschiedener Eiweiß-Typen (die meisten davon sind Enzyme, also Bio-Katalysatoren). Jeder Typ, wie wir an den Beispielen "Histon H4" und "Rubisco" gesehen haben, hat ganz charakteristische Aminosäuren-Abfolgen.

 

Nun bitte ich Sie, sich wieder an den Beitrag 13 zu erinnern, an die "Geheim-Code"-Tabelle für unsere Sätzchen aus Großbuchstaben. Mit den Kleinbuchstaben a, c, g, und t haben wir Großbuchstaben verschlüsselt. So ähnlich sind auch die Abfolgen der Aminosäuren von Eiweißen verschlüsselt in der Abfolge der DNA-Bausteine a, c, g, und t in der Erbsubstanz, der DNA. Somit sieht dann eine genetische Code-Tabelle unserer "Geheim-Code"-Tabelle recht ähnlich. Und somit sehen sich auch die Abfolgen auf der DNA immer ähnlicher, je enger die Arten miteinander verwandt sind. Auch diese Tatsache kann man für die Bestimmung von "Verwandtschaft" zwischen den Arten oder allgemein zwischen Lebewesen verwenden [2].

Systematiker vergleichen oder könnten auf diese Art und Weise zehntausende Eiweißtypen miteinander vergleichen, zwischen Sorten, zwischen Arten und Gattungen oder auch die acgt-Abfolge auf der DNA oder auch beides und noch viele andere Eigenschaften. Alles recht kompliziert.

Und nun die Gretchenfrage: Was meinen Sie, die Sorten, die die größten Übereinstimmungen zeigen, sind auch immer miteinander kreuzbar?.....?.........? Ich sag's Ihnen: Meistens, ja. Aber nicht immer!

Deshalb stellen wir jetzt mal die einfache Frage (auf die es nur komplizierte Antworten gibt): Was ist denn nun eine Art? Art-Begriffe und Definitionen gibt's eine ganze Menge, aber die Antwort von Grünlingen, die ja allesamt Biologie mit Schwerpunkt Systematik studiert haben, kommt promt: Eine "biologische Art" besteht aus Lebewesen, die miteinander Nachkommen zeugen können; so was wie eine Fortpflanzungsgemeinschaft. Nur dann, aber auch nur dann, gehören sie zu einer Art und nur dann darf man "vielleicht" ein Gen von einer Sorte gegen das in einer anderen Sorte oder das in einer Wildform austauschen.

Wenn es denn nur so einfach wäre! Zunächst ist der Ausdruck "biologische Art" nichts als eine Definition. Menschen lieben Definitionen, denn es erleichtert ihnen Ordnung in ihr Leben zu bringen und miteinander zu kommunizieren, oft zumindest ganz gut, aber manchmal auch weniger gut. Im Fall von Gentechnik ziemlich schlecht, im Fall von Pflanzen-Gentechnik äußerst schlecht.

Aber nehmen wir doch mal Tisch: Häh??? Tisch? Ja, Tisch. Irgendwas mit einem Tisch hatten wir in Beitrag 07. Nehmen wir als ganz einfaches Beispiel "Tisch". Der hat Beine, manchmal auch nur ein Bein, und eine waagerecht Platte. Aber ist jedes Gebilde mit Bein und Platte ein Tisch? Was haben wir, wenn die Beine mehr als zwei Meter lang sind und die Platte eine Größe von 5 Meter mal 2,5 Meter hat? Richtig, einen überdachten Abstellplatz für Autos, einen "Carport". Noch etwa größer und es könnte ein kleiner Steg über einen Bach draus werden. Lassen wir Beine und Platte mal etwas schrumpfen, die Beine auf 50 cm. Was haben wir dann? Entweder einen Hocker oder einen Wohnzimmertisch. Nun kann ich den Hocker als Tisch und den Tisch als Hocker benutzen. Es kommt also auch darauf an, wie ich so eine Ding verwende. Ein dicker massiver Holzklotz ganz ohne Beine kann auch als Tisch oder Hocker Verwendung finden. Vergrößere ich das Ganze, dann bekomme ich diesmal sicher keinen Carport und auch keinen Steg.

Das zeigt uns: Auch einfache Dinge sind schon gar nicht so einfach zu definieren. Obwohl beim Tisch könnte uns das noch gelingen; zumindest, wenn sich Leute mit Gentechnik-Phobie und solche, die Gentechnik realistisch sehen, ernsthaft zusammensetzen.

Ja, und wie definieren wir nun so etwas kompliziertes wie "biologische Art"; unzählige Male komplizierter als ein Tisch? Für Grünlinge ist das ganz einfach: Nur das, was zusammenkommen kann und Nachwuchs in die Welt setzen kann, gehört zur selben Art. Punkt, aus. Daran haben sich sogar Biologen zu halten, die sich auf so was wie Systematik spezialisiert und ihr ganzes Leben beruflich damit beschäftigt haben und erfahren müssen, dass es mit diesen Definitionen gar nicht so einfach ist.

Man braucht - wenn man denn ernsthaft daran interessiert ist - nur mal lesen, welche Mühe Biologen hatten und immer noch haben, eine Art zu definieren.

Naiv wie ich bin, gleich mal eine blöde Frage an die Grünlinge: Da haben sich nun zwei junge glückliche Menschen gefunden und hätten gerne Kinder. Also, es sollte sich dabei schon um ein Weiblein und ein Männlein handeln. Die beiden machen alles richtig, aber es klappt nicht. Sie nehmen alle Möglichkeiten der modernen Medizin in dieser Hinsicht in Anspruch, aber es klappt nicht. Schließlich kommen sie in ein Alter, wo es auch normalerweise nicht mehr klappt. Wer von beiden gehört denn jetzt zur Spezies "Mensch"? Nach der klaren Lesart von Grünlingen gehören die beiden ja wohl eindeutig unterschiedlichen Arten an? Oder ist vielleicht deren Definition von Art nicht ganz richtig? Kommen bei dieser traurigen Geschichte vielleicht leise Zweifel auf?

Wenn Sie meinen, dass sei ein blödes Beispiel, dann nehmen wir doch Folgendes: Vielleicht haben Sie ja schon von Weizen und Roggen gehört. In Biologenkreisen werden beide als unterschiedliche Getreidearten angesehen und sogar in unterschiedliche Gattungen eingeordnet. Trotzdem kann man beide kreuzen und bekommt tatsächlich Nachkommen. Die nennt man Triticale. Nun hätten die Grünlinge aber schon ein Problem mit ihrer Definition, denn: Triticale ist nicht nur eine "Art-Hybride", sondern sogar eine "Gattungs-Hybride". Wie schlimm.

Nur mal so unkommentiert und platt formuliert zum Vergleich: Triticale, das wäre so was, wie die Nachkommen einer Kreuzung zwischen Mensch und Schimpanse.

Also sind Weizen [7] und Roggen doch nur EINE Art? Da steht nun Grünlingsmeinung gegen die von studierten Biologen. Aber die Grünlingsmeinung steht sich auch selbst im Weg. Grünlinge sind der festen Überzeugung, dass Artgrenzen nicht überschritten werden dürfen. Das zumindest behaupteten sie immer im Brustton der Überzeugung im Zusammenhang mit Gentechnik. Manche sind auch etwas generöser. Wenn's den "natürlicherweise" vorkommt, wie bei Triticale, dann ist das schon OK. Und dann gibt es noch folgende Beobachtung: Manchmal können Arten tatsächlich von einem Tag auf den anderen entstehen. Suchen Sie im Internet unter "Polyploidie und Artbildung".

Ja, ab wann ist es denn für Grünlinge nicht mehr OK und unnatürlich? Die Antwort haben sie vor kurzem schon gegeben und haben ihr Lügengebäude bezüglich Pflanzen-Gentechnik damit selbst entlarvt. Die Antwort hat nämlich mit "Art" oder "Nicht-Art" gar nichts zu tun, das ist nur eine vorgeschobene Behauptung für solche Mitbürger wie Tante Olga, Onkel Paul und Karlchen (in Beitrag 01), die kaum was von moderner Biologie verstehen.

Nachdem es den Züchtern nun nämlich gelingt, Gene von einer Sorte in eine andere Sorte DERSELBEN Art zu fügen [3], ohne dass auch nur der geringste Fitzel von "fremdem" Erbmaterial dranhängt, protestieren sie trotzdem. Weil, ja weil Grünlinge nun die Methode kurzerhand als "Gentechnik" bezeichnen und ablehnen, weil sie von Gentechnikern entwickelt wurde. Aber die Methoden an sich sind gar keine Gentechnik mehr, sondern Mutagenese-Methoden, so ähnlich wie wir sie im Blog jetzt viele Male erwähnt haben. Nur man hat sie perfektioniert. Sie sind definierter, berechenbarer, sicherer und ziemlich genau. Bürokraten kratzen sich nun unentwegt am Kopf, wie sie so was definieren könnten. Das Dumme ist: Je nachdem wie man die neuen Methoden einsetzt, kann was gentechnisches oder was nicht-gentechnisches herauskommen. Das ist der reinste Horror für Gentechnik-Hasser. Es ist schon eine Krux mit den Definitionen. Grünlinge ficht das nicht an; sie definieren, wie es ihnen am Besten in den Kram passt. Was soll man dazu sagen? Vielleicht sollten sie die Spenden, die sie eifrig einsammeln für ein Biologiestudium verwenden. Das ist eine ganze Ecke schwieriger als sich Fantanstereien und blindem Aktivismus hinzugeben. Werfen Sie doch selbst mal einen Blick auf das, was z.B. im Wikipedia-Lexikon über "Art oder Spezies" steht, kommen Ihnen da nicht auch größte Zweifel, ob es Grünlinge wirklich besser wissen als Biologen, die sich auf dieses Gebiet in einem langen Studium spezialisiert haben und es am Ende immer noch nicht genau sagen können.

Um "Art" zu verstehen, ist es ähnlich wie mit "Gen". Alles sehr kompliziert. Und nun gehört darüber hinaus auch noch beides zusammen, Gen und Art.

Es gehört z.B. dazu, wie es vom Gen, also der Erbanlage, zur Eiweißbildung kommt und von da zur Entwicklung und zum Aussehen eines Lebewesens mit seinen ganz (art-)eigenen Eigenschaften.

Haben Sie einen Moment Geduld. Ich schaue einmal nach, auf wie vielen Seiten das Thema "Von der Erbsubstanz (DNA) zum Eiweiß (Protein)" in meinen Lehrbüchern, die bei mir zu Hause herumstehen, abgehandelt wird. Sie müssen es nicht lesen, denn es kommen wieder eine ganze Reihe von Fachausdrücken vor. Deshalb habe ich es auch kursiv geschrieben.

DNA? Das hatten wir schon extrem kurz in Beitrag 05 angesprochen;Regulation? In Beitrag 12. Regulation mit eventuellem DNA-Umbau, mit Chromatin-Struktur-Veränderung, mit Transkription, mit RNA-Interferenz, mit Exon-Intron-Strukturen und mit (alternativem) Spleißen, mit Transport, mit Translation, mit Proteinmodifikation, mit Rezeptoren? Ach, ja da fehlen noch die kleinen regulatorischen RNAs.

Alles zusammen 200 - 300 Seiten? Das müsste aber auch kürzer gehen, wenn man die Bildchen alle weglässt. 150 Seiten?

Grundlagen zum DNA-, RNA- und Eiweißaufbau? Mit Gen-Struktur, mit Replikation, mit Reparatur-Systemen, mit Transkription und Translation. Es fehlen noch so obskure Dinge wie Operon. Nein, nein, nicht nur die in Bakterien, sondern die in Mitochondrien und Chloroplasten, die man in Pflanzen findet.

150 - 300 Seiten?

Und ganz wichtig, es fehlt noch Evolution; also wie Arten überhaupt entstehen [4]. 50 -100 Seiten?

All diese Dinge und noch mehr brauchen wir, um die "Art"-Grenzen zu beleuchten, wenn es so etwas scharf Trennendes überhaupt geben sollte. Trotz all dem wirkt die Behauptung "man darf Gene nicht von einer Art in eine andere Art übertragen" auf die Bevölkerung besonders beeindruckend im Kampf um eine "genfreie" Natur .

Kommen wir noch mal auf den "Tisch" zurück. Was würden Sie von einem halten, der sich als Tisch-Experte bezeichnet und behauptet: Nur ein Ding, das aus einer viereckigen Platte besteht, die genau 3 cm dick, 80 cm breit und 150 cm lang ist und exakt vier Beine mit einem Durchmesser von genau 8 cm und und einer Länge von genau 70 cm hat, nur das ist ein Tisch. Alles andere das ähnlich aussähe, dürfe man nicht als Tisch bezeichnen? Was würden Sie von so einem halten? Um es einmal freundlich auszudrücken: Man müsste ein wenig Mitleid mit diesem Experten haben.

 

 

Jetzt BITTE große AUFMERKSAMKEIT für paar Bemerkungen zu Gentechnik und Süßkartoffel. (In Beitrag 16 finden Sie dazu mehr Information.) Die werden angebaut in riesigen Mengen als Nahrungspflanze in den Tropen und Subtropen für Milliarden von Menschen? Zum Vergleich: Weltweit kommen immerhin etwa 2 kg Süßkartoffeln (Bataten) auf je 7 kg Kartoffeln. Dieses Beispiel möchte ich Ihnen etwas ausführlicher schildern. Ich hoffe, ich kann es auch anschaulich genug darstellen, denn es ist wichtig.

Was ist nun mit den Süßkartoffeln? Wahrscheinlich haben sie es gar nicht bemerkt, weil es von Grünlingen und ihren grünlichen Reportern, die sich im Medienwesen breitgemacht haben, nur ganz kurz und beiläufig erwähnt wurde, um es dann schnellst möglich wieder in der Versenkung verschwinden zu lassen. Tja, halten Sie sich fest, so seit Anfang des Jahres 2015 haben es Forscher aus Belgien, Peru, China und USA gemeinsam veröffentlich: Die Süßkartoffel ist von Natur aus eine Gentechnik-Pflanze und das seit mindestens 8000 Jahren!!! Ohne Gentechniker, ganz natürlich entstanden! [5] Ich kann mir nun ein extra breites Grinsen wirklich nicht verkneifen. Heutzutage werden jährlich weltweit mehr als 100 Millionen Tonnen davon angebaut und gegessen. Aber es kommt noch toller. Sie werden es nicht glauben. Wissen Sie, welche Gene in der Süßkartoffel stecken? Welche Gene sich da zwischen die Süßkartoffelgene gemischt haben. ....Na? ....Bakterien-Gene! Und wissen Sie auch, aus welcher Bakterienart die Gene stammen? Mein Grinsen kann ich einfach nicht abstellen. Aus genau den Bakterien, die in vielen Fällen Gentechniker benutzen, um gewünschte Gene in Kulturpflanzen zu transferieren. Man nennt sie Agrobakterien. Und wissen Sie auch wieviel Bakterien-Erbsubstanz (DNA) in der Süßkartoffel steckt? Bis zu fünf aktive Agrobakterien-Gene. Das ist etwa 15 mal so viel DNA, wie man bei der gentechnischen Methode von diesen Agrobakterien benötigt, nämlich nur zwei kleine DNA-Stückchen. Die Süßkartoffeln aber, die enthalten außer diesen aktiven Agrobakterien-Gene auch noch eines dieser beiden Stückchen. Es tut mir Leid, ich möchte durch mein permanentes Grinsen nicht unhöflich erscheinen, aber es geht im Moment nicht anders. Da sage jetzt noch einer, Gentechnik sei nicht natürlich [6]. Die Natur macht's uns vor und wir machen's nach. So grenzt der Grünlingsglaube an den mittelalterlichen Hexenwahn. Gentechnik ist des Teufels, man muss sie austreiben, wo immer es geht. Basta.

Wann beginnt also der große Feldzug der Grünlinge gegen die Süßkartoffel? Ich verrate es Ihnen, gar nicht; denn sonst würden sie sich völlig lächerlich machen, die Grünlinge. Es ist wie bei der "roten Gentechnik", die man zur Medikamenten-Herstellung einsetzt: Am Anfang großspurig dagegen agitieren, Fortschritt und Entwicklung in Deutschland verhindern, aber jetzt möglichst nicht auffallen und still sein. Ich werde mal nachsehen, was auf den Webseite der Grünlinge über diese "gentechnisch" veränderten Süßkartoffeln steht..... Ich finde nichts. Vielleicht suchen Sie mal.

 

Ganz zum Schluss dieser Beiträge noch ein Satz zum Einprägen: Pflanzenzüchtung ist nicht Selbstzweck, ihre Methoden sind wichtige Werkzeuge. Pflanzenzüchtung ist eine der Grundlagen für unser aller Wohl, für unsere sichere Versorgung mit Nahrung auch in der Zukunft. So banal und trivial und abgedroschen wie es klingen mag: Ohne sichere ausreichende Nahrung gibt es keine stabilen Gesellschaften.

 

Zum Nachschauen oder zur Ergänzung:

[1] Ribulosebisphosphat-Carboxylase/Oxygenase. Es hilft den Pflanzen das Kohlendioxyd der Luft zu binden. In vielen weiteren biochemischen Schritten bauen die Pflanzen daraus ihre gesamte Körpersubstanz auf. Ohne Rubisco wächst keine Pflanze, es sei denn man "füttert" sie mit Zucker. [2] Hier lasse ich wieder zur Vereinfachung einiges weg; z.B.: Weil es für eine Aminosäure mehr als ein Codon geben kann, kann die acgt-Dreier-Abfolge auf der DNA selbst bei zwei identischen Proteinen (in zwei verschiedenen Arten) etwas variieren. [3] Auf die Methoden habe ich schon ganz kurz in Beitrag 06 hingewiesen. Hier noch mal die Stichworte unter denen Sie im Internet nachsehen können: ZFN, TALEN, CRISPR oder Genom-Editing. [4] Ein interessantes Büchlein hat der Evolutionsbiologe Ernst Mayr für interessierte Laien mit Vorkenntnissen geschrieben. Es heißt: Das ist Evolution. Goldmann Verlag (2005). Es umfasst 378 Seiten! [5] Schauen Sie mal bei Wikipedia nach. Am 20.09.2015 habe ich zuletzt nachgesehen. Darüber findet man eine Zeile, ohne weitere Erklärung, aber mit Hinweis auf die Literatur. Sie müssen schon genau hinsehen, um es zu finden. Den Titel der Original-Veröffentlichung habe ich Ihnen mal verständlich übersetzt: "Das Erbgut der Kultur-Süßkartoffel enthält T-DNA mit aktiven Erbanlagen aus Agrobakterien: Ein Beispiel für eine auf natürliche Weise gentechnisch veränderte Kulturpflanze". [6] Es sind noch eine ganze Reihe anderer Fälle von "natürlicher Gentechnik" bekannt; diese (Kultur-) Pflanzen, dienen uns nicht als Nahrung. Ein Beispiel wäre Tabak. [7] Selbst verschiedene Weizensorten sind schon Gattungs-Hybride.

 

 

Nicht vergessen:

► Zufällige Verdrehungen und Einfügungen bei Mutationszüchtung, aber auch ganz "normale" Züchtung können den Sinn im Erbgut verändern. Beitrag 08.

► Im Jahr 2013 wuchsen weltweit schon mindestens 10 Billionen gentechnisch veränderter Pflanzen auf den Feldern. Beitrag 09.

► Ein Tabellarischer "Gefahren"-Vergleich von Züchtung mit und ohne Gentechnik. Beitrag 09.

► Grünlinge wollen uns ihre Vorstellungen von Natur und Technik aufzwingen. Beitrag 10

► Information sollte man sich eigentlich bei bei kompetenten Fachleuten holen. Beitrag 11.

► Lassen Sie sich nicht durch "kluges" Geschwätz verängstigen. Egal ob gentechnisch, herkömmlich oder "Bio": Die Regulation und das Stoffwechselgleichgewicht kann bei jeder Pflanze aus dem Gleichgewicht geraten. Solange die Pflanze uns schmeckt und bekömmlich ist, ist es völlig belanglos. Beitrag 12.

► Nicht Gentechnik, sondern ganz natürliche Erbgutveränderung ist besonders unberechenbar, wie man mit dem genetischen Code zeigen kann. Beitrag 13.

 

 

 

...Pause...



Lieber Leser, falls sie es bis hierhin geschafft haben, haben Sie mir eine große Freude bereitet. Nicht weil ich meine, dass mein Geschreibsel von großem literarischem Wert, besonders anregend oder besonders klug ist, sondern einfach aus dem Grund, weil ich annehmen muss, dass Sie ab jetzt doch vielleicht den schrillen und lauten Tönen von grünlichen Aktivisten ein wenig skeptischer lauschen. Das wäre tatsächlich wunderbar.

Auch hoffe ich, dass Sie nun nicht mehr zu jenen gehören, die sogar die Kennzeichnung aller Lebensmittel befürworten, welche DNA enthalten (Beitrag 01 und 03). Wenn schon Kennzeichnung, dann aber bitte ALLE Produkte, bei denen zu irgend einem Zeitpunkt gentechnische Methoden Verwendung gefunden haben und dann ganz wichtig auch, Kennzeichnung aller Pflanzen bei denen die Züchter besonders harsch und rabiat durch Mutagenese in das Erbgut unserer Kulturpflanzen eingegriffen haben, also ALLER Mutanten-Pflanzen und deren Produkte (Beitrag 07 und 08).

Nicht, dass ich persönlich für Kennzeichungen wäre, ganz im Gegenteil. Aber wenn schon Kennzeichnung, dann sollte man konsequent sein und sich nicht nur das aussuchen, was einem aus spenden-ideologisch-politischen Gründen opportun erscheint und dem dann auch noch einen grünlich moralischen Anschein verpassen.



Pause: Ab jetzt werde ich nur noch sporadisch neue Beiträge hier einstellen oder die eingestellten ergänzen.



Ihr Gentechnik-Freund.





Nicht vergessen:

 

► Weltweit wurden in 2013 auf 1,7 Millionen Quadratkilometer gentechnisch gezüchtete Nutzpflanzen angebaut. Beitrag 03.

► Wenn wir nicht gerade fasten, dann essen wir jeden Tag viele Milliarden fremde Gene oder - was das gleiche ist - viele Milliarden fremde Erbanlagen. Beitrag 03.

► Keine Züchtung ist so schnell und effizient wie die gentechnische, wenn nicht so viele völlig unnötige "Sicherheitsuntersuchungen" vorgeschrieben wären. Beitrag 04.

► Gentechnisch gezüchtete Pflanzen sind harmloser als normal gezüchtete!"

Beitrag 04.

► Gene sind dünn, lang und essbar. Je natürlicher und weniger zubereitet Fleisch, Gemüse und Obst sind, desto mehr völlig intakte Gene. Beitrag 05.

► Bei den meisten althergebrachten Sorten weiß man bis heute nicht, was genau so alles verändert ist. Beitrag 06.

► Bei Mutantenzüchtung (aber auch bei Kreuzungszüchtung) entsteht eine unübersehbare Vielzahl an Nachkommen; nicht so bei der gentechnischen Züchtung. Mutantenzüchtung erweitert aber erfolgreich die "natürliche" Auslese-Züchtung. Beitrag 07.

► Zufällige Verdrehungen und Einfügungen bei Mutationszüchtung, aber auch ganz "normale" Züchtung können den Sinn im Erbgut verändern. Beitrag 08.

► Im Jahr 2013 wuchsen weltweit schon mindestens 10 Billionen gentechnisch veränderter Pflanzen auf den Feldern. Beitrag 09.

► Ein Tabellarischer "Gefahren"-Vergleich von Züchtung mit und ohne Gentechnik. Beitrag 09.

► Grünlinge wollen uns ihre Vorstellungen von Natur und Technik aufzwingen. Beitrag 10

► Information sollte man sich eigentlich bei bei kompetenten Fachleuten holen. Beitrag 11.

► Lassen Sie sich nicht durch "kluges" Geschwätz verängstigen. Egal ob gentechnisch, herkömmlich oder "Bio": Die Regulation und das Stoffwechselgleichgewicht kann bei jeder Pflanze aus dem Gleichgewicht geraten; solange die Pflanze uns schmeckt und bekömmlich ist, ist es völlig belanglos. Beitrag 12.

► Nicht Gentechnik, sondern ganz natürliche Erbgutveränderungen sind besonders unberechenbar, wie man mit dem genetischen Code zeigen kann. Beitrag 13.

► Art-Grenzen bei Pflanzen sind reine Definitionssachen. Kulturpflanzen ohne fremde Gene ist ein Illusion, Nahrung ohne Gentechnik ist ein Illusion, wenn schon seit tausenden von Jahren erst Millionen und dann Milliarden Menschen Süßkartoffeln als Nahrung zu sich nehmen.