Juni 2019

 

 

20....präziser geht’s nicht...

 

 

(oder: Von der Natur lernen!

 

Die Superzüchtungsmethode CRISPR/Cas)

 

 

„CRISPR/Cas“. Sie runzeln die Stirn und denken: „Merkwürdige Überschrift für einen Beitrag der leicht verständlich sein soll“. Keine Sorge, ich versuche mein Bestes und erklär' s von vorne. Allerdings, auf ein wenig Mithilfe ihrerseits bin ich angewiesen, sonst könnten doch zu viele Fragezeichen im Raum stehen bleiben. Damit es nicht zu langatmig wird, verweise ich zur Erinnerung auf den einen oder anderen meiner Blogbeiträge.

Bisher war es meine Absicht Ihnen zu erläutern, weshalb ich gentechnisch gezüchtete Pflänzchen, die von renommierten Firmen, Saatgutbetrieben und Instituten stammen, für absolut unbedenklich halte [1]. Wenn es eine Steigerung für „absolut unbedenklich“ gäbe, dann würde das für die CRISPR/Cas-Methode zutreffen. Ich habe mich redlich bemüht Sie mit Spezial- und Fachausdrücken zu verschonen. Das werde ich auch weiterhin tun. Aber was - um Himmelswillen - ist denn nun „CRISPR/Cas“?

Die Antwort eines eingefleischten [2] Grünlings ist klar: „ Eine perfide neue Gentechnik-Methode, manipulierte Gentechnik, hinterhältige Gentechnik, um der gefährlichen alten Gentechnik Tür und Tor zu öffnen“. Ein paar Grünlinge geraten ob dieser Antwort jedoch ein wenig ins Grübeln. [3]

Die Antwort von Naturwissenschaftlern und Medizinern dazu ist begeisternd: „Eine neue fantastische Methode für die Forschung, für die Biotechnologie, für die Züchtung, für die Humanwissenschaften, für die Medizin, für die Gesundheit und das Wohlbefinden der Menschheit“. Einige Naturwissenschaftler und Mediziner geraten ob dieser Antwort jedoch auch ein wenig ins Grübeln. Sie sehen also, lieber Leser, über „CRISPR/Cas“ [4] gibt es ein ganzes Spektrum von Ansichten.

Grenzen wir unsere Meinungsumfrage daher einmal stark ein und fragen nur die kompetenten Pflanzenzüchter. Antwort: „Eine neue fantastische Züchtungsmethode.“ Und? Gibt es unter den Pflanzenzüchtern keine Grübler? Wohl kaum. Alle sind ausnahmslos optimistisch! [5]

Gesellen wir uns zu den Optimisten und betrachten die neue Superzüchtungsmethode hier nur mit Blick auf die Pflanzen [6]. Wir können dazu auf die Beiträge 07 und 13 zurückgreifen. In Beitrag 07 ging es um Betriebsanleitungen, um 50-bändige Betriebsanleitungen, jeder Band mit 10.000 Seiten. Diese Bände sollten uns den Umfang der Erb-Information veranschaulichen, so wie er in jeder Zelle eines Lebewesens in Form von extrem dünnen [7] aber riesig langen [8] DNA-Fäden zu finden ist. Dazu sollten Sie sich vorstellen, was herauskommt, wenn man die Textzeilen eines solchen Bandes fortlaufend aneinanderhängt: Insgesamt fünfzig 125 km lange dünne Papierstreifen resultieren in 6000 km Streifensalat. Nun habe wir in Beitrag 07 erstens (I) einen älteren Gentechniker, zweitens (II) einen noch älteren Mutantenzüchter und drittens (III) uralt „Mutter Natur“ auf diesen Streifensalat jeweils separat in einer Kammer einwirken lassen. Der Gentechniker (I) fügte einen winzigen Extrastreifen mit sinnvoller Information hinzu, der Mutantenzüchter (II) verbrachte einen ganzen Arbeitstag mit Schneiden und Zusammenkleben, mit Löschen und Ändern von Buchstaben zu. Mutter Natur (III) werkelte ähnlich wie der Mutantenzüchter am Textband herum, jedoch mit sehr großer Zurückhaltung. Schauen Sie sich die Art und Weise der Behandlung und die Ergebnisse noch einmal in Beitrag 07 an.

Hier möchte ich die Analogie um eine Züchtungskammer erweitern. In einen separaten vierten dunklen Raum (IV) nimmt der Züchter weder Schere noch Kleber noch Stifte mit. Er hat einen kleinen - ich nenne es an dieser Stelle mal - „CRISPR/Cas-Miniroboter“ dabei [9]. Der hat z.B. den Auftrag den folgenden unpassenden Text „... den Nippel durch die Lasche ziehen und mit der kleinen Kurbel ganz nach oben drehen...“ [10], der auf unerklärliche Weise in die Betriebsanleitung geraten ist, zu löschen. Der Text steht so ungefähr bei Kilometer 4797. Sobald der Züchter den winzigen Roboter in die Kammer gegeben hat [11], setzt der sich selbständig auf einen der Papierstreifen, rast an ihm entlang, springt auf den nächsten Streifen und findet dann bei km-Stand 4797 tatsächlich die zu löschende Stelle. Er schneidet vor „den“ und hinter „drehen“ und verbindet die Schnittstellen. Der unsinnige Text ist entfernt. Auch einen einzelne Buchstaben auf den Millimeter genau bei Position 3625(Komma),297465  km auszuwechseln ist kein Problem. Dazu müssen Sie wohl dem „CRISPR/Cas-Miniroboter“ eine neue entsprechende Anweisung mitgeben, wie z. B. diese: Tausche bei km-Position 3625,297465 ein a gegen ein g aus. Nachdem der Miniroboter seine Arbeit getan hat, wird er in einem nächsten althergebrachten Züchtungsschritt herausbefördert.

Erinnern Sie sich bitte, für was die Analogie mit den Kammern stehen soll: Die Räume sollen Pflanzenzellen darstellen, die Buchstabenstreifen die fast unendlich langen acgt-DNA-Fäden. Aber für was sollen die Miniroboter stehen? Was ist mit den Minirobotern? Wie sieht denn so ein „CRISPR/Cas-Miniroboter“ aus? Wie groß ist er? Woraus besteht er? Was hat es mit den Anleitungen auf sich? Woraus besteht eine Anleitung? Wie findet er sein Ziel auf diesen ewig langen Erbfäden aus DNA?

Die Antwort ist eigentlich ganz einfach: Eiweiß und RNA! Ja, der CRISPR/Cas-Miniroboter besteht aus Eiweiß und RNA! Eiweiß? Das ist uns schon öfter im Blog begegnet. Damit meine ich jetzt nicht nur das gliberige Zeug in rohen Hühnereiern, das nach dem Kochen so wunderbar weiß aussieht. Alle Riesenmoleküle, die aus Ketten von Aminosäure-Molekülen bestehen, bezeichnet man als „Eiweiße“. Biochemiker nennen Sie lieber „Proteine“. Wenn die Aminosäureketten kurz sind, bezeichnet man sie auch als „Peptide“. Von den Eiweißen gibt es je nach Lebewesen in jedem tausende bis zehntausende Sorten. Sehen Sie in Beitrag 13 und 14 nach. Dort heißt es unter anderem: „...Eiweiße sind beides zugleich: „Befehl und Vollstrecker“ oder - weniger martialisch - „Anweisung und automatisch arbeitende Spezialmaschine“ oder noch anders „Anleitung und Spezialkatalysator“. Wirklich fantastisch! Diese biologischen Katalysatoren heißen Enzyme. Enzyme sind Eiweiße oder - was das gleiche ist – Proteine.“ Ja. Solche biologischen Katalysatoren könnte man auch als „Miniroboter“ bezeichnen, als ganz natürliche molekülgroße „Roboter“.

Und nun zu RNA. RNA? Ich habe mich bisher mehr oder weniger erfolgreich darum herumgedrückt, Ihnen RNA zu erläutern [12]. Sie ist ähnlich dünn, aber nicht so riesig lang wie DNA, oft nur so lang wie ein einzelnes Gen. Die Buchstaben aus denen RNA zusammengesetzt ist, sind a, c, g, und (statt t) ein u [13]. RNA wird von der DNA abkopiert und enthält damit u.a. auch die verschlüsselte Information für Eiweißbildung [14]. In den Zellen der Lebewesen gibt es mehr RNA als DNA. Eiweiß und RNA vollbringen gemeinsam in Lebewesen wahre Wunder.

Schauen wir uns nun zunächst einmal an, was die verwendeten CRISPR/Cas-Miniroboter (zusammengesetzt aus Eiweiß und RNA) in unserem Beispiel in der zusätzlichen Kammer Nr. 4 fabriziert haben:

Im ersten Fall eine Deletion [15], also das, was auch ganz natürlich und spontan und irgendwo an den riesig langen Erb-Fäden hätte passieren können: Ein kurzes oder längeres DNA-Stückchen geht verloren. Wann, wo und wieviel verloren geht, darauf hatten die Züchter mit den alten Mutagenese-Methoden keinen Einfluss. Sie mussten sich mit dem zufrieden geben, was sie finden konnten. Vielleicht hätten sie ja nach jahrelanger Suche oder raffinierten Kreuzungsverfahren mal ein Pflänzchen gefunden, bei dem wenigstens ein Teil des unsinnigen Textes verlorengegangen wäre. Vielleicht hätte man es mit einer radioaktiven Strahlenkanone beschleunigen können, aber dann wäre die Gefahr drastisch gestiegen, andere wichtige Teile der DNA-Betriebsanweisung zu zerstören. Mit CRISPR/Cas ist das alles kein Problem: Auf den Punkt genau herausschneiden und sonst nichts verändern. Einfach fantastisch!

Und nun der zweite Fall, ein a austauschen gegen ein g, eine Punktmutation. Wie der Name schon andeutet, soll nur an einer winzigen Stelle im Erb-Material auf den riesig langen DNA-Fäden was verändert werden: Ein, zwei Buchstaben austauschen, vielleicht auch ein, zwei, drei Buchstaben ausschneiden oder einfügen. So, wie es ganz natürlich und spontan an den riesig langen Erb-Fäden täglich in den Zellen eines jeden Lebewesens durch „Mutter Natur“ passiert. Mit den neuesten CRISPR/Cas-Versionen ist das auf den Punkt genau möglich. Kein Problem.

Und wenn doch was anderes noch verändert worden wäre?!“ Lieber Leser, Sie haben sicherlich schon die reflexartigen Grünlings-Einwände schmerzlichst vermisst; deshalb sofort noch weitere kleine grünliche Kostproben: „Die CRISPR/Cas Methode ist nicht unfehlbar und somit gefährlich. Sie könnte ja an der falschen Stelle schneiden; sie könnte ja auch an falschen Stellen Buchstaben austauschen; außerdem könnte die Regulation auf Abwege geraten; außerdem könnten epigenetische Vorgänge [16] gestört sein; außerdem enthält die Pflanze für einige Zeit fremde DNA-Stücke und man weiß nicht, ob diese tatsächlich für immer aus der Pflanze entfernt werden können und außerdem... und außerdem... und außerdem lauern da Gefahren.“ Sie ahnen's schon: „Und daher ist es Gentechnik“. Es muss auf die lange Bank geschoben und jahrzehnte getestet werden. Im Lichte dessen, was wir bisher von gefährlichen Strahlenkanonen und auch giftigen mutagenen Chemikalien gehört haben, könnte ich Ihnen, lieber Leser, getrost die Antwort auf all die Einwände überlassen. Aber darf ich Ihnen noch ein wenig Hilfestellung geben? Mit den neuesten Versionen von CRISPR/Cas alles kein Problem. Alle diese wüsten Bedenken laufen völlig ins Leere. Nun sollten gewissenhafte Wissenschaftler, Techniker, Forscher nie „Nie“ sagen. Selbst wenn wirklich einer der hypothetischen Fälle einträfe, dann suchten sich die Züchter einfach aus den Dutzenden mit CRISPR/Cas gezüchteten Pflänzchen das Beste aus den Nachkommen heraus. So, wie sie es bei den althergebrachten Züchtungsmethoden schon immer gemacht haben. So ahnungslos wie Grünlinge sind Züchter jedenfalls nicht.

 

Eine andere einfache Analogie, um zu zeigen, was bei CRISPR/Cas passiert, ist tatsächlich ein Computer-Schreibprogramm. In fast unendlich langen Texten kann man mit dem Computer in kürzester Zeit nach ganz bestimmten Textpassagen suchen und Korrekturen vornehmen. Was bei Grünlingen sofort zu blankem Entsetzen führt: Mit einem Schreibprogramm können Sie doch tatsächlich in eine deutsche Betriebsanweisung auch „artfremde“ Texte in englisch, französisch, türkisch, lateinisch oder was auch immer exakt einfügen - und das in eine deutsche Betriebsanweisung! Mit anderen Worten: Mal funktioniert CRISPR/Cas wie „Natur“ oder eine optimierte Korrektur-Methode und mal wie Gentechnik. Eingefügte artfremde Texte wären fürchterlichste Gentechnik. Oh, Graus. Wie kann man nur solche Entwicklungen zulassen? Wie wär's mit einem diktatorischen Welt-Ober-Grünling, der über all unsere Forschungsaktivitäten ein unerbittlich-wachsam-esoterisch-ignorantes Auge hätte?

 

Was heißt eigentlich CRISPR/Cas? Da ich bis dato keinerlei Anstalten unternommen habe, Sie über die Bedeutung dieses Kürzels aufzuklären, haben Sie wahrscheinlich in der Zwischenzeit schon längst danach „gegoogelt“ und herausgefunden, es heißt vom Englischen [17] ins Deutsche übersetzt so viel wie: „Gruppierte, Regelmäßig Unterbrochene, Kurze, Palindromische Wiederholungen / und diesen (also GRUKPW, kurz: G)zugeordnetes Protein“..….???

….??? Und damit wissen Sie auch schon, wie das Ganze funktioniert…..!!! Spaß beiseite!

Eigentlich könnten Sie sich an dieser Stelle beruhigt zurücklehnen. Denn vom „Prinzip“ her wissen Sie nun schon, wie sich die CRISPR/Cas-Methode von Züchtungsmethode I, II oder III in Beitrag 07 unterscheidet.

Sollten Sie sich aber - wider Erwarten - für mehr Details interessieren, dann erfahren Sie nun ein wenig mehr über die Entdeckung, Herkunft und „Natur“ des Miniroboters CRISPR/Cas.

Fangen wir ganz von vorne an: Für einen Nicht-Biologen sind alle Biologen seltsame Typen, die in der Natur herumrennen, fast alles was da kreucht und fleucht mit Namen kennen und die über die Eigenschaften von jedem dieser Millionen Lebewesen lange Geschichten erzählen können. Das, lieber Leser, ist ein Irrtum. Nicht-Biologen können sich gar nicht vorstellen, wie viel Unbekanntes es noch zu erforschen gibt. Die meisten Biologen hantieren in Labors mit Kolben und Gläsern, mit Pipetten und Messbechern, mit Chemikalien und physikalischen Analysegeräten und mit einem oder ein paar wenigen Lebewesen. Sie sind hoch spezialisiert und arbeiten an minutiösen Details; selten ganz allein, meist mit ein paar anderen zusammen, die sich für ähnlich minutiöse Details interessieren. Und minutiöse Details gibt es unzählige. Unzählige Details, die dann beschrieben werden in hoch speziellen Fachzeitschriften. Wenn sich ein paar andere Spezialisten dafür interessieren, freuen sich die Autoren. Ansonsten passiert wenig. Nichts aufregendes. Vielleicht vergleichbar mit einer Kuchensorte, die statt 50 Gramm Rosinen nun 70 Gramm enthält oder einem PKW, der ein paar PS mehr hat als sein Vorgänger. Man würde mit den Schultern zucken und sagen: „Na, und?“ Sie wissen in etwa, was ich meine?

Einen kleinen Unterschied gibt es: Erscheinen die Ergebnisse in einer Fachzeitschrift, dann haben wir die Kenntnisse über unseren Lebensraum, über die Natur, über die Welt, über das, was es so alles gibt, ein winziges Bisschen vermehrt. „Na, und? Ist das denn wichtig?“ Antwort: Das wissen wir nicht. Manchmal, wenn Naturwissenschaftler mit ihrer Forschung ein ganz bestimmtes Ziel verfolgen, ahnen oder wissen sie vielleicht, dass sie ihrem Ziel näher gekommen sind oder es sogar erreicht haben. Meist aber sammeln sich unzählige Daten einfach nur an und niemand weiß, ob dabei was „Nützliches“ herauskommt. Nehmen wir mal ein Beispiel:

 

…........(Position 2.877.616) >

tgatgggtttgaaaatgggagctgggagttctaccgcagaggc

gggggaactccaagtgatatccatcatcgcatccagtgcgcccggtttatcc

ccgctgatgcggggaacaccagcgtcaggcgtgaaatctcaccgtcgttgc

cggtttatccctgctggcgcggggaactctcggttcaggcgttgcaaacctggctaccggg

cggtttatccccgctaacgcggggaactcgtagtccatcattccacctatgtctgaactcc

cggtttatccccgctggcgcggggaactcccgggggataatgtttacggtcatgcgccccc

cggtttatccccgctggcgcggggaactctgggcggcttgccttgcagccagctccagcag

cggtttatccccgctggcgcggggaactcaagctggctggcaatctctttcggggtgagtc

cggtttatccccgctggcgcggggaactctagtttccgtatctccggatttataaagctga

cggtttatccccgctggcgcggggaactcgcaggcggcgacgcgcagggtatgcgcgattcg

cggtttatccccgctggcgcggggaactcgcgaccgctcagaaattccagacccgatccaaa

cggtttatccccgctggcgcggggaactctcaacattatcaattacaaccgacagggagcc

cggtttatccccgctggcgcggggaactcagcgtgttcggcatcacctttggcttcggctg

cggtttatccccgctggcgcggggaactctgcgtgagcgtatcgccgcgcgtctgcgaaag

cggtttatccccgctggcgcggggaactctctaaaagtatacatttgttcttaaagcattttttcc

cataaaaacaacccaccaaccttaatgtaacatttccttattattaaagatcagctaattctttgttt

< (Position 2.878.500)..............[18].

 

„Nicht schon wieder“, stöhnen Sie, „es nervt langsam.“ Könnte man meinen. Aber das, was Sie gerade angeschaut haben, ist ein Teil von CRISPR. Wir sind dabei uns mitten ins Fachgetümmel über CRISPR/Cas zu stürzen, zumindest in die Anfänge davon! Das Entziffern der acgt-DNA-Baustein-Reihenfolge gehört zu jenen Tätigkeiten von Forschern, bei denen man oft nicht weiß, ob es wichtig ist oder nicht.

An dieser Stelle müssen wir uns jetzt einmal kurz von den Pflanzen abwenden und den Bakterien zuwenden. Auch Bakterienzellen enthalten Millimeter (!) lange, extrem dünne DNA-Fäden als Erbsubstanz. Bakterien sind winzig. Nur wenn Millionen Nachkommen einer einzigen Zelle übereinander getürmt zusammen liegen, kann man sie als stecknadelkopfgroßen Haufen erkennen [19]. Aus so einem Häuflein Bakterien kann man die Erbsubstanz - also DNA - herausholen und dann die acgt-Buchstabenfolge bestimmen. Einen kleinen Teil des Ergebnisses konnten Sie gerade oben bewundern. Eigentlich waren die Wissenschaftler 1986 an der acgt-Reihenfolge eines Gens mit Namen „iap“ interessiert [20], dessen acgt-Buchstabenfolge vor der Position 2.877.616 (siehe oben) liegt und nur durch Pünktchen (.…...) angedeutet ist. Mit dem allerdings, was hinter dem iap-Gen kommt und was ich Ihnen oben aufgeschrieben habe, konnten die Forscher erst einmal gar nichts anfangen. Im Lauf von 20 Jahren fand man Ähnliches bei immer mehr Bakterienarten, meist nur auf einen winzigen Bereich der langen Bakterien-DNA-Fäden begrenzt.

Was aber ist nun das Besondere an dieser acgt-Reihenfolge? Um Ihnen das zu zeigen, möchte ich nicht die acgt-Buchstabenfolge verwenden, sondern es einfacher mit Worten und Wortbruchstücken unseres Alphabets darstellen: …

dicht nebel und leben fort virales dna stück

dicht nebel und leben fort dna stück aus virus

dicht nebel und leben fort bacteriophagen dna

dicht nebel und leben fort virus erbsubstanz

dicht nebel und leben fort bakterien viren hüllprotein

usw.

Ich weiß, dass Sie jetzt wieder Ihre Augenbrauen fragend hochziehen und „Hm“ murmeln. Bleiben Sie dran! Wir erkennen: Die Worte „dicht nebel und leben fort“ wiederholen sich in regelmäßigen Abständen, getrennt durch jeweils ganz verschiedene andere Buchstabenfolgen. Die Leerzeichen und Absätze dazwischen sind nur für's bessere Erkennen. Die müssen Sie sich wegdenken:

...dichtnebelundlebenfortviralesdnastückdichtnebelundlebenfortdnastückausvirus... usw. Die kurzen Buchstabenfolgen „nebel...leben“, sind Palindrome:nebel“ rückwärts gelesen ergibt „leben“ und umgekehrt. Diese Palindrome kommen wiederholt vor. Wie heißt nochmal meine Übersetzung von CRISPR ins Deutsche? GRUKPW : „Gruppierte, Regelmäßig Unterbrochene, Kurze, Palindromische Wiederholungen. Aha! da haben wir's! So einfach ist das! Die kurzen Palindrom-Wiederholungen „nebel...leben“ werden durch andere unterschiedliche Buchstabenfolgen regelmäßig unterbrochen. Diese Wiederholungen hocken als Gruppe zusammen auf einem (oder einigen) winzigen Bereich der Bakterien-DNA-Fäden. Wenn man als Fachmann auf die acgt-Originalsequenz schaut, erkennt man die gleiche Struktur der Wiederholung bei der obigen acgt-Abfolge (...tccccgctggcgcgggga...). Als Laie erkennen Sie es nur dann, wenn Sie wissen, dass DNA in den Zellen aus komplementären Doppelsträngen besteht. Dann im Jahr 2007, also 20 Jahre später, fiel es Forschern - man könnten fast sagen - wie Schuppen von den Augen [21]: Die Stücke zwischen den Wiederholungen stammen eigentlich aus Viren. Viren ...? [22] Viren in Bakterien...? [23] Viren-DNA-Stückchen, also Virus-Erbsubstanz in Bakterien-DNA-Fäden? Für Sie, lieber Leser, vielleicht überraschend? Für Biologen zu dieser Zeit war das schon was ganz Normales und nichts Aufregendes. Vielleicht denken Sie aber auch, was interessieren mich denn Krankheitserreger von Bakterien, ich möchte wissen, was schlimm an diesen neuen Gentechnik-Methoden ist. Ich versichern Ihnen: Nichts ist daran schlimm, vorausgesetzt man geht vernünftig damit um, so wie bei jeder anderen Technik auch. Gedulden Sie sich noch ein wenig, dann geht es weiter mit CRISPR/Cas. Ich werde Ihnen erklären, dass CRISPR/Cas ganz natürlich ist. „Von der Natur lernen“, das sollte selbst Grünlinge begeistern. Oder?

In der Bionik guckt man sich technisch Wundersames [24] von der Natur ab! Sehen wir nach, was sich Forscher von Bakterien abgeschaut haben. Dabei spielen die Viren eine große Rolle.

Viren sind - Pi mal Daumen - 40 mal kürzer als Bakterien. Viren könne Bakterien befallen, ihnen arg zusetzen und sie manchmal umbringen. Wenn die Bakterien es überleben, können sie sich wappnen gegen einen erneuten Angriff. Eine Möglichkeit, wie sie das können, entdeckte man schon in den 1950er Jahren, eine zweite Möglichkeit sich zu schützen kurz vor 1970. Letztere Entdeckung und ein paar weitere eröffneten den Forschern Mitte der 1970er Jahre das Tor zur „alten Gentechnik“ [25]. Von der Natur lernen! Die dritte Variante schließlich, wie sich Bakterien schützen können, führte zur CRISPR/Cas-Methode und somit zur neuen aktuellen Züchtungstechnik. Von der Natur lernen! Nur die dritte Möglichkeit will ich hier grob skizzieren:

Hat ein Bakterium eine erste Virus-Attacke erfolgreich überstanden, fällt es ihm und seinen Nachkommen leichter einer erneuten heftigeren Attacke des gleichen oder ähnlichen Virus-Typs zu widerstehen. Das erinnert stark an das menschliche Immunsystem: Nach Impfungen oder erfolgreich überwundenen Infektionen sind wir besser gegen die nächsten Attacken von Krankheitskeimen gewappnet. Nun sind Bakterien rund eine Million mal kürzer als Menschen und damit nur 2 Mikrometer oder zweitausenstel Millimeter lang. Eine Bakterie kann als einzelne kleine Zelle überleben und sich vermehren. Wir sind aus mehr als 30 Billionen größeren Zellen zusammengesetzt, die kooperieren müssen, damit wir überleben. Und so verläuft bei Bakterien der Abwehrmechanismus gegen einen erneuten Virusbefall auch anders ab als bei uns, aber darum nicht weniger pfiffig.

Viele Viren besitzen als Erbsubstanz DNA [26]. Diese unterscheidet sich in den acgt-Abfolgen von der der Bakterien. Vergleichen könnten wir das in etwa mit dem Unterschied zwischen Dialekten. Es würde Ihnen sofort auffallen, wenn z.B. in einer hochdeutschen Betriebsanweisung plötzlich ein Kapitel auf Bayrisch verfasst ist. Bakterien „erkennen“ eingedrungene Virus-Erbsubstanz an deren „acgt-Dialekt“. Überleben Bakterien die Attacke und schaffen es, kleine Stücke Virus-DNA in ihr eigenes Erbmaterial „als Muster“ einzufügen, dann haben sie gute Chancen den nächsten Angriff der gleichen Virusart zu überleben. Die Muster-Stückchen werden an ganz bestimmten Stellen im Erbgut eingesetzt. Und genau das habe ich Ihnen ein paar Absätze vorher anhand einer Analogie beschrieben: Dort wurden die Stückchen eingefügt zwischen die Wiederholungen von „dichtnebelundlebenfort“ (oder wissenschaftlicher von „cggtttatccccgctggcgcggggaactc“). Soweit zu „CRISPR“. Nun zu Cas“. Nein! Halt!

Noch eine wichtige Frage! Was veranstalten die Bakterien eigentlich hier, ganz natürlich? Sie packen Fremd-DNA in ihre eigene Erbsubstanz. Erinnert das nicht ein wenig an eine Methode, die man als Gentechnik bezeichnet? Ein Grünling würde natürlich heftigst protestieren: Das ist ja nur zum eigenen Schutz der Bakterien und außerdem ist es „natürlich“. Mein Frage wäre: Wieso sie dann mit aller Macht Gentechnik bekämpfen, die, und daran besteht nicht der geringste Zweifel, die wir zu unserem eigenen Schutz gegen zukünftige Nahrungsmittelknappheit brauchen können. Was ist daran unnatürlich? Von der Natur lernen!

Nun zu „Cas“. Meine Erklärungen versuche ich für Sie so einfach wie möglich zu halten. Alles ist in Wirklichkeit komplizierter, auch was ich Ihnen nun über Cas berichte: Cas ist der Kurzname für ein bestimmtes Gen [27]. Meistens ist ein Gen ein DNA-Abschnitt, der in verschlüsselter Form die Information für die korrekte Abfolge der Bausteine zum Zusammenbau eines Eiweißes enthält [28]. Und dieses Eiweiß des Gens „Cas“ soll – wie alle Eiweißsorten – etwas Bestimmtes machen. Ja, das Cas-Eiweiß ist ein wichtiger Teil unseres Miniroboters und soll DNA-Fäden zerschneiden. Damit das Enzym „Cas“ überhaupt DNA-Fäden zerschneiden kann, braucht es eine genaue Anleitung. Und die holt es sich von der CRISPR-Stelle, denn dort gibt es ja Virus-DNA-Stücke. Es bekommt Kopien davon, Kopien aus RNA. Mit diesen Kopien saust es durch die Bakterienzelle und vergleicht die acgu-Abfolge seiner Kopie mit der acgt-Abfolge sämtlicher DNA-Fäden, die es in der Bakterienzelle finden kann. Hat es eine Stelle gefunden, die passt, dann schneidet das Eiweiß Cas an dieser Stelle die Erbsubstanz entzwei. Sollte diese Stelle auf einer Virus-DNA liegen, dann hat das Virus, das gerade im Begriff war eine Zelle zu infizieren, Pech gehabt: Erbsubstanz kaputt, Angriff misslungen!

Die CRISPR-Stelle auf der Erbsubstanz der Bakterien selbst, die ja lauter Virus-DNA-Stücke als Muster enthält, ist durch ihre besondere palindromische Struktur vor Cas geschützt.

 

Von der Natur lernenist ein Motto dieses Beitrags. Wie kann man aus all dem Geschilderten nun eine neue Züchtungsmethode entwickeln, so wie es im wesentlichen von den beiden Forscherinnen (!) Emmanuelle Charpentier und Jennifer Doudna durchgeführt wurde.

Hier eine der Anleitungen, einmal ganz, ganz einfach dargestellt [29]:

Man nehme im Labor die acgt-Abfolge von CRISPR (Schritt 1). Die habe ich Ihnen oben in der original Reihenfolge vorgestellt.

Man ersetze den nicht wiederholten acgt-Text - also die Virus-DNA-Stückchen - durch einen ähnlich kurzen acgt-Text (Schritt 2) aus dem Erbgut einer Pflanze, die man verändern möchte. Nehmen wir an, Ihnen gefällt ein a-DNA Baustein nicht, wie ich es ziemlich am Anfang (bei „Punktmutation“ und „km-Stand 3625,297465“) beschrieben habe. Sie möchten diese Stelle also ändern, vielleicht das „a“ entfernen.

Zum veränderten CRISPR packe man die acgt-Abfolge vom Gen Cas dazu (Schritt 3), denn Sie brauchen ja den kompletten CRISPR/Cas-Miniroboter. Die acgt-Reihenfolge von Cas finden Sie hinter der Position 2.878.500. Naja, da habe ich es mir nun einfach gemacht und dort ein paar Pünktchen (……) hingetippt. Sie müssen mir glauben, dass dort die acgt-verschlüsselte Information für das Cas-Enzym liegt [32]. Eigentlich brauchen die Gentechniker eine leicht veränderte Cas-acgt-Version (Schritt 4), damit es eben in Pflanzen funktioniert.

Wir stecken nun die veränderte CRISPR-acgt-Version (2) mit der auch ein wenig veränderten Cas-acgt-Version (4) in eine Pflanzenzelle.

Das Cas-Protein wird nun ganz natürlich von der Pflanzenzelle hergestellt. Es holt sich eine RNA-Kopie von der veränderten CRISPR-acgt-Version (2), die ja nun zwischen den Palindromwiederholungen kurze veränderte Pflanzen-acgt-Abfolgen enthält.

Mit dieser Kopie rast der CRISPR/Cas-Miniroboter am Erbmaterial der Pflanzenzelle entlang und sucht eine Stelle mit der gleichen acgt-Abfolge. Hat er sie gefunden, schneidet er. Er schneidet einfach die Pflanzenerbsubstanz entzwei. Das wäre für die Pflanzenzelle allerdings genauso fatal, wie es für das Virus weiter oben war. Denn mit einem zerschnittenen oder zerrissenen Erbfaden (Chromosom) lässt es sich nicht gut leben. Zum Glück hat die „Natur“ in allen Lebewesen vorgesorgt. Da patroullieren nämlich in der Zelle auch solche Eiweißtypen, solche biologischen Katalysatoren (kurz: Enzyme), die die geschnittenen Enden wieder zusammenfügen können. Wenn Sie nun denken, das haben die Pflanzenzellen wegen CRISPR/Cas „erfunden“, dann liegen Sie falsch. So ein Zerreißen von Erbfäden ist eine ganz natürliche Sache und kommt gar nicht so selten spontan vor, seit es Lebewesen und natürliche Radioaktivität auf dieser Welt gibt. Daher brauchen alle Lebewesen Reparatur-Enzyme. Die Reparatur verläuft nun meistens nicht so perfekt, wie es eigentlich nötig wäre. Hauptsache für die Zelle, der Erbfaden ist zusammengeflickt. Was an der Flickstelle zurückbleibt ist oft eine Mutation [30], eine ganz natürliche Mutation. Und das ist genau das, was der Züchter braucht. Der möchte in unserem Beispiel das „a“ entfernen [33]. Hauptsache für den Züchter, das „a“ ist weg (oder andere Buchstaben an dieser Stelle) [31]. Wenn aus dieser Pflanzenzelle eine ganze Pflanze regeneriert wird, kann niemand in der Welt nachträglich nachweisen, ob hier zuvor unser CRISPR/Cas-Miniroboter den Faden zerschnitten hat oder der Faden ganz spontan zerrissen war. Den letzten Satz nochmal ganz langsam für Grünlinge: Niemand in der Welt kann nachträglich erkennen, ob hier unser CRISPR/Cas-Miniroboter am Werk war oder der Faden ganz natürlich zerrissen war. Das fehlerhafte Zusammenfügen der Fadenenden erfolgt in beiden Fällen ganz natürlich. Und damit sind wir fast am Schluss des 20. Beitrags angelangt. Damit es nicht noch länger wird, habe ich Ihnen hier nur den technisch einfachsten Fall geschildert. Von der Natur lernen!!!

Welche tollen Dinge man bei Pflanzen noch mit der neuen Methode anstellen kann, deutete ich Ihnen ganz am Anfang dieses Beitrags an und verweise hier auf drei - für Sie hoffentlich verständliche - Texte zur neuen Züchtungsmethode:

 

https://www.transgen.de/lexikon/1845.crispr-cas.html

https://www.transgen.de/forschung/2590.crispr-talen-genome-editing-pflanzen.html

https://www.transgen.de/forschung/2564.crispr-genome-editing-pflanzen.html

 

Zum Nachschauen oder zur Ergänzung:

[1] Um grünlichen Einwänden gleich zu begegnen: „Absolut unbedenklich“ in dem Sinn, so wie ich auch einen Tisch oder Stuhl für unbedenklich halte. In einem eskalierenden Streit kann natürlich beides, aber auch so ziemlich jeder andere Gegenstand, Schäden beim Gegner verursachen  [2] Eingefleischt und Grünling passt wohl nicht zusammen; ich meine es hier im übertragenen Sinn  [3] https://progressive-agrarwende.org/ oder auch Prof. Dr. Niggli Urs, Direktor und Institutsleiter am Forschungsinstitut für biologischen Landbau FiBL: http://www.taz.de/!5290509/  [4] Ein paar andere neue Methoden bringen Ähnliches zustande wie CRISPR/Cas, sind aber technisch aufwendiger: z.B. ZFN, TALEN  [5] Abgesehen von grünlichen, esoterischen Experten, die sich für kompetente Züchter halten  [6] Im Weiteren konzentriere ich mich hier auf Pflanzen. Die CRISPR/Cas-Methode kann bei allen Lebewesen angewendet werden  [7] Größenordnungsbereich von 1 Nanometer = 1 milliardstel Meter = 1 millionstel Millimeter  [8] je nach Lebewesen so zwischen 1 mm und 10 cm  [9] Ich erkläre es Ihnen so unkompliziert wie ich kann. Sie wissen schon, es ist komplizierter. Und weil es komplizierter ist, so muss es für Grünlinge selbstredend auch „gefährlich“ sein  [10] von Mike Krüger  [11] Falls ein Neunmalkluger nun meint, es sind aber viele kleine Roboter, dann noch mal meine Erinnerung: Ich vereinfache hier Vieles, um Sie, lieber Leser, nicht mit unzähligen Details zu verjagen oder zu erschlagen  [12] RNA kommt ganz kurz vor in: a) Beitrag 05 bei den Lehrbuchzitaten zur Gen-Definitionen, b) Beitrag 12 in einem Lehrbuchzitat von zwei anerkannten deutschen Genetikern, c) einer Fußnote in Beitrag 13, d) Beitrag 14 in Aufzählungen, um Sie, lieber Leser, zu beeindrucken e) Beitrag 16 und f) Beitrag 17, wo Grünlinge unbedarften Mitmenschen in beindruckender Weise die riesigen Gefahren der gentechnisch gezüchteten Pflänzchen vermitteln wollen  [13] Die RNA-Buchstaben unterscheiden sich chemisch ein klein wenig von den DNA-Buchstaben. Sie enthalten ein Sauerstoffatom mehr  [14] In Beitrag 13 finden Sie ein einfaches Beispiel für die Verschlüssselung  [15] Das Wörtchen „Deletion“ finden Sie z.B. in Beitrag 08, 09, 12 und 13  [16] Epigenetik ist so was wie eine kompliziertere Regulation, die sogar über mehrere Generationen wirksam sein kann  [17] CRISPR/Cas = Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR‐associated protein  [18] auch hier müssen Sie sich das ganze als ununterbrochene acgt-Folge ohne Absätze vorstellen. Vorher stehen noch (über den Daumen gepeilt) knapp 3 Millionen und nachher kommen noch knapp 2 Millionen weitere Buchstaben  [19] Das nennt man auch: Kolonie [20] Genau hinter diesem Gen da liegt die CRISPR-Stelle. Wenn Sie möchten, dann klicken Sie auf folgenden Link: https://www.ncbi.nlm.nih.gov/gene/947215. Gehen bis zu ersten Grafik. Dort finden Sie Zahlen im Bereich von 2.877.600 ff. Da liegt das Ende des iap Gens. Mit gedrückter Maus können Sie das ganze ein wenig hin und her schieben. Klicken Sie ein paarmal auf die kleine Lupe mit dem +Zeichen bis ACGT-Buchstaben erscheinen. Bei 2877710 erscheint dann die Abfolge ccccgctggcgcgggg oder in Großbuchstaben CCCCGCTGGCGCGGGG. Dann haben Sie die CRISPR-Stelle gefunden. Hier noch das Zitat der Originalveröffentlichung mit der CRISPR-Stelle: Ishino Y et al.: Nucleotide sequence of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. Journal of Bacteriology 169, 5429-5433 (1987)  [21] Barrangou et al.: CRISPR provides acquired resistance against viruses in prokaryotes. Science Vol. 315, 1709 (2007)  [22] Viren habe ich bisher in meinem Block noch nicht erwähnt, wenn Sie mehr wissen wollen, schauen Sie woanders nach. Hier nur extrem kurz etwas über diese merkwürdigen Gebilde: Ja, auch Viren enthalten Erbsubstanz, also Betriebsanleitungen in Form von z.B. DNA mit acgt-Abfolgen. Nur in lebenden Zellen „erwachen“ Viren „zum Leben“. Gelangen Viren in eine Zelle, lassen sie sich dort vermehren. So wie Agrobakterien die Pflanzen zwingen den übertragenen (Gen-)Anweisungen zu folgen (siehe Beitrag 16), so zwingen nämlich die Viren die Bakterien dazu neue Viren zu bilden  [23] Erinnern Sie sich noch an Beitrag 14 und 16? Da fand man winzige Mengen Bakterien-DNA in den riesig-langen DNA-Fäden von Süßkartoffeln. Hier ist es Viren-DNA in Bakterien!  [24] Schlagen Sie Bionik im Internet nach. Zwei Beispiele: Lotus-Effekt, wo Wasser von den Blättern der Lotus-Pflanze einfach abperlt, ohne einen Wasserfilm zu bilden oder Ultraschallortung bei Delfinen und Fledermäusen als Vorbild für dieUltraschall-Untersuchungin der Medizin  [25] Einfache Schneide- und Zusammenfüge-Werkzeuge für DNA-Fäden in Form von Enzymen (Eiweißen als Katalysatoren) waren die Ausbeute dieser Entdeckungen. Weiteres finden Sie im Internet auch unter den Begriffen Restriktionsenzymen, Ligasen u.a.  [26] Andere Virus-Arten haben als Erbsubstanz auch RNA  [27] Eigentlich sind es mehrere, deren Produkte zusammenarbeiten und sich ergänzen  [28] Schauen Sie in Blogbeitrag 13 nach [29] Sie wissen: Ein bisschen komplizierter ist es schon. Hier geht‘s wieder um‘s Prinzip  [30] In Blockbeitrag 13 finden Sie Beispiele für Mutationen  [31] Sehen Sie in Beitrag 13 nach  [32] oder verfahren Sie wie in Amerkung 20 und schieben den acgt-Bereich rechts noch ein wenig weiter über den CRISPR-Bereich hinaus; dann kommen Sie zur Cas-Stelle, d.h. den Cas-Genen   [33] vielleicht möchten Sie ja, dass ein unerwünschter „Befehl“ nicht mehr ausgeführt werden kann. Erinnern Sie sich noch an Beitrag 13. Vielleicht wollen Sie ja verhindern, dass Zuckermoleküle nicht mehr gespalten werden ( und somit die Früchte süßer )